Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16146
Trapped Gene
Lsm4 (ENSMUSG00000031848)
Vector Insertion
Chr 8: 73200496 - 73201676
Public Clones E056D10 (ggtc)
Private Clones OST466051 (lexicon) OST394365 (lexicon) OST292158 (lexicon) OST289459 (lexicon)
OST45300 (lexicon) OST45299 (lexicon) OST7601 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000225998 (Chr8:73200454..73200495 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGACAGCGCAGAATCAC Chr8:73200470..73200489 60.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000225998 (Chr8:73200454..73200495 +)
Downstram Exon
ENSMUSE00000213763 (Chr8:73201677..73201775 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGACAGCGCAGAATCAC Chr8:73200470..73200489 60.14 50 CAGATGCCCGTTGTAGGTCT Chr8:73201721..73201740 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682766 Chr8:73197278..73197356 TTATCGCTGCAGGGAAGATG Chr8:73197337..73197356 61.27 50
upstream ENSMUSE00000225998 Chr8:73200454..73200495 TGAAGACAGCGCAGAATCAC Chr8:73200470..73200489 60.14 50

*** Putative Vector Insertion (Chr 8: 73200496 - 73201676) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213763 Chr8:73201677..73201775 CAGATGCCCGTTGTAGGTCT Chr8:73201721..73201740 60.13 55
downstream ENSMUSE00000213764 Chr8:73201853..73202033 CGCACCATGTCAATGATCTC Chr8:73201950..73201969 60.08 50
downstream ENSMUSE00000636306 Chr8:73202259..73202642 AAGTGGGGCTTCACACAAAG Chr8:73202424..73202443 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAAGACAGCGCAGAATCA Chr8:73200470..73200490 60.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAAGACAGCGCAGAATCA Chr8:73200470..73200490 60.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031848