Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16151
Trapped Gene
Rprd2 (ENSMUSG00000028106)
Vector Insertion
Chr 3: 95570344 - 95575918
Public Clones IST11542A11 (tigm)
Private Clones OST466018 (lexicon) OST457888 (lexicon) OST451380 (lexicon) OST422427 (lexicon)
OST380333 (lexicon) OST367034 (lexicon) OST363651 (lexicon) OST360893 (lexicon)
OST323646 (lexicon) OST292605 (lexicon) OST259609 (lexicon) OST214484 (lexicon)
OST211495 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000566198 (Chr3:95575919..95576119 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACCAGTCCCAGCAACCTC Chr3:95576064..95576083 59.72 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000566198 (Chr3:95575919..95576119 -)
Downstram Exon
ENSMUSE00000566197 (Chr3:95563796..95570343 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACCAGTCCCAGCAACCTC Chr3:95576064..95576083 59.72 60 ACAGCTGAGGCCTAACTCCA Chr3:95564490..95564509 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000566196 Chr3:95622470..95622876 GGCTTGTCGTCCTGGTGTAT Chr3:95622529..95622548 60 55
upstream ENSMUSE00000176218 Chr3:95594023..95594152 TCCCCATCGTTTGAATCTCT Chr3:95594126..95594145 59.48 45
upstream ENSMUSE00000392753 Chr3:95591207..95591307 TCTGGGAAGATCGAAATGTG Chr3:95591247..95591266 58.64 45
upstream ENSMUSE00000176217 Chr3:95590243..95590320 CAACCGAATAAGCAGTGGAA Chr3:95590254..95590273 58.77 45
upstream ENSMUSE00000566202 Chr3:95590243..95590374 CCATAATGCCAGACTGCAAA Chr3:95590339..95590358 59.69 45
upstream ENSMUSE00000176223 Chr3:95588977..95589029 ATCCACGAATCCAAAAGCTG Chr3:95589009..95589028 60.07 45
upstream ENSMUSE00000393155 Chr3:95588137..95588263 AGGCCCTCATTGAAGAGTTG Chr3:95588240..95588259 59.28 50
upstream ENSMUSE00000448226 Chr3:95584338..95584513 TGGGCCCTCACTAACAGAAG Chr3:95584400..95584419 60.25 55
upstream ENSMUSE00000448220 Chr3:95580438..95580720 AGGAATCACCAGTCCCCTCT Chr3:95580622..95580641 59.93 55
upstream ENSMUSE00000448213 Chr3:95578183..95578295 AGTGTCTCGAAAGCCTCACC Chr3:95578205..95578224 59.46 55
upstream ENSMUSE00000448268 Chr3:95578064..95578180 CCTTCCCCAACTTTGGTTTT Chr3:95578112..95578131 60.19 45
upstream ENSMUSE00000566199 Chr3:95578035..95578295 CCTTCCCCAACTTTGGTTTT Chr3:95578112..95578131 60.19 45
upstream ENSMUSE00000566198 Chr3:95575919..95576119 CTACCAGTCCCAGCAACCTC Chr3:95576064..95576083 59.72 60

*** Putative Vector Insertion (Chr 3: 95570344 - 95575918) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000566197 Chr3:95563796..95570343 ACAGCTGAGGCCTAACTCCA Chr3:95564490..95564509 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTCCTGAGCCAGGATAAT Chr3:95572863..95572883 58.69 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGACGTGACTGGGAAAACC Chr3:95572851..95572871 61.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGCTCCCAAGCACTACGTT Chr3:95573089..95573109 60.32 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGCTCCCAAGCACTACGTT Chr3:95573089..95573109 60.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028106