Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16176
Trapped Gene
Ick (ENSMUSG00000009828)
Vector Insertion
Chr 9: 77961263 - 77979101
Public Clones IST10548H8 (tigm) IST14674D3 (tigm)
Private Clones OST465664 (lexicon) OST464362 (lexicon) OST456569 (lexicon) OST456131 (lexicon)
OST441711 (lexicon) OST441691 (lexicon) OST431715 (lexicon) OST373185 (lexicon)
OST372186 (lexicon) OST305702 (lexicon) OST277397 (lexicon) OST181307 (lexicon)
OST148347 (lexicon) OST59009 (lexicon) OST38916 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717105 (Chr9:77961122..77961262 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717105 (Chr9:77961122..77961262 +)
Downstram Exon
ENSMUSE00000271954 (Chr9:77979102..77979378 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718633 Chr9:77956999..77957288 No primer for this exon
upstream ENSMUSE00000710535 Chr9:77961107..77961262 No primer for this exon
upstream ENSMUSE00000717105 Chr9:77961122..77961262 No primer for this exon

*** Putative Vector Insertion (Chr 9: 77961263 - 77979101) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000271954 Chr9:77979102..77979378 No primer for this exon
downstream ENSMUSE00000718273 Chr9:77979102..77979378 No primer for this exon
downstream ENSMUSE00000271937 Chr9:77983403..77983457 No primer for this exon
downstream ENSMUSE00000271907 Chr9:77987783..77987904 No primer for this exon
downstream ENSMUSE00000271877 Chr9:77989001..77989080 No primer for this exon
downstream ENSMUSE00000531636 Chr9:77998336..77998468 No primer for this exon
downstream ENSMUSE00000271822 Chr9:78001372..78001543 No primer for this exon
downstream ENSMUSE00000271797 Chr9:78003156..78003323 No primer for this exon
downstream ENSMUSE00000271778 Chr9:78005448..78005759 No primer for this exon
downstream ENSMUSE00000271746 Chr9:78008176..78008366 No primer for this exon
downstream ENSMUSE00000271723 Chr9:78008470..78008618 No primer for this exon
downstream ENSMUSE00000531625 Chr9:78012338..78012466 No primer for this exon
downstream ENSMUSE00000714696 Chr9:78012338..78013220 No primer for this exon
downstream ENSMUSE00000271684 Chr9:78014717..78014839 No primer for this exon
downstream ENSMUSE00000404025 Chr9:78015407..78015745 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTTCCAGAGAGCTCAAATG Chr9:77967214..77967235 60.66 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGAAGAAAGAGACACGCTGAG Chr9:77967258..77967280 59.8 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009828