Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16185
Trapped Gene
D930028M14Rik (ENSMUSG00000074274)
Vector Insertion
Chr 7: 25940640 - 25941112
Public Clones IST14345G7 (tigm) IST10740E12 (tigm)
Private Clones OST465434 (lexicon)
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636464 (Chr7:25940341..25940639 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGGGACTGTCCAGGATT Chr7:25940589..25940608 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636464 (Chr7:25940341..25940639 +)
Downstram Exon
ENSMUSE00000636463 (Chr7:25941113..25941642 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGGGACTGTCCAGGATT Chr7:25940589..25940608 59.96 55 ATCGCTGGGTCTAAGGAGGT Chr7:25941182..25941201 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636465 Chr7:25937476..25937645 CATCACCCCATACTCCCCTA Chr7:25937577..25937596 59.62 55
upstream ENSMUSE00000636464 Chr7:25940341..25940639 CTGTGGGACTGTCCAGGATT Chr7:25940589..25940608 59.96 55

*** Putative Vector Insertion (Chr 7: 25940640 - 25941112) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636463 Chr7:25941113..25941642 ATCGCTGGGTCTAAGGAGGT Chr7:25941182..25941201 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAAGCCCCACCCTGTGTAA Chr7:25940674..25940694 59.85 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000074274