Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16186
Trapped Gene
Dsg2 (ENSMUSG00000044393)
Vector Insertion
Chr 18: 20716846 - 20731989
Public Clones IST14568E8 (tigm)
Private Clones OST465431 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720126 (Chr18:20716747..20716845 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720126 (Chr18:20716747..20716845 +)
Downstram Exon
ENSMUSE00000402351 (Chr18:20731990..20732025 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AAGTCCGTTTCCAAAGTCCA Chr18:20732019..20732038 59.57 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000573056 Chr18:20716608..20716845 CCCTCCTCCATCTAGGCTGT Chr18:20716609..20716628 60.61 60
upstream ENSMUSE00000712551 Chr18:20716656..20716845 GTCCCGCAGAGTCAGAGAAG Chr18:20716684..20716703 60.13 60
upstream ENSMUSE00000720126 Chr18:20716747..20716845 No primer for this exon

*** Putative Vector Insertion (Chr 18: 20716846 - 20731989) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000402351 Chr18:20731990..20732025 AAGTCCGTTTCCAAAGTCCA Chr18:20732019..20732038 59.57 45
downstream ENSMUSE00000384276 Chr18:20733441..20733575 CCCTCTTTTGACGAACCAAG Chr18:20733510..20733529 59.71 50
downstream ENSMUSE00000407262 Chr18:20737541..20737702 CTTCCCGGTCAAGAATGCTA Chr18:20737688..20737707 60.21 50
downstream ENSMUSE00000368138 Chr18:20737835..20737979 GTGCTGCACTCAATTCCTCA Chr18:20737982..20738001 59.99 50
downstream ENSMUSE00000369599 Chr18:20739013..20739179 GCGGTGATTTTCATCACAAG Chr18:20739040..20739059 59.13 45
downstream ENSMUSE00000382404 Chr18:20741209..20741346 GCTTCCACCGTCAAGGAATA Chr18:20741243..20741262 60.07 50
downstream ENSMUSE00000708541 Chr18:20741209..20741417 GCTTCCACCGTCAAGGAATA Chr18:20741243..20741262 60.07 50
downstream ENSMUSE00000455889 Chr18:20741438..20741623 ATGTGGAAATAGCCCCCTTC Chr18:20741580..20741599 60.15 50
downstream ENSMUSE00000720044 Chr18:20741438..20744054 TGCTTGGAAGTGTGCTATGC Chr18:20741870..20741889 60.02 50
downstream ENSMUSE00000455884 Chr18:20748449..20748714 CGGAAAGAGACTACGCTGCT Chr18:20748624..20748643 59.78 55
downstream ENSMUSE00000455881 Chr18:20750335..20750477 CTGAAGTGACGGAGTCCACA Chr18:20750393..20750412 59.86 55
downstream ENSMUSE00000455875 Chr18:20750773..20751000 TTCCTGGTGCGTTATTTTCC Chr18:20751002..20751021 59.94 45
downstream ENSMUSE00000455868 Chr18:20752565..20752792 CGCATACAGTGAGCTGAAGG Chr18:20752690..20752709 59.62 55
downstream ENSMUSE00000455862 Chr18:20754461..20754582 AGGTGCCCCTTCATTATTCC Chr18:20754573..20754592 60.15 50
downstream ENSMUSE00000453360 Chr18:20756840..20757169 CTCTTGTCCTTACGGCTTCG Chr18:20757089..20757108 60.01 55
downstream ENSMUSE00000407103 Chr18:20759814..20761308 CGACCTAGGCAAACTTCAGC Chr18:20760010..20760029 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGTCAACCACCATGGATA Chr18:20722879..20722899 60.05 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACCACCATGGACGTGACT Chr18:20722884..20722904 61.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044393