Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16191
Trapped Gene
Ppp1r2 (ENSMUSG00000047714)
Vector Insertion
Chr 16: 31260755 - 31261315
Public Clones not available
Private Clones OST465324 (lexicon) OST419792 (lexicon)
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000423475 (Chr16:31261316..31261393 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGACGATGAAGACGCCTA Chr16:31261367..31261386 61.21 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000423475 (Chr16:31261316..31261393 -)
Downstram Exon
ENSMUSE00000423470 (Chr16:31260660..31260754 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGACGATGAAGACGCCTA Chr16:31261367..31261386 61.21 55 CTCCCGAGTCCGATACTTTG Chr16:31260687..31260706 59.69 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466452 Chr16:31274932..31275363 CGATCGTGGAAGAGGAACTG Chr16:31274934..31274953 60.79 55
upstream ENSMUSE00000652940 Chr16:31274932..31275078 CGATCGTGGAAGAGGAACTG Chr16:31274934..31274953 60.79 55
upstream ENSMUSE00000423486 Chr16:31265391..31265498 CATATCATCCCGCTGACAAA Chr16:31265438..31265457 59.5 45
upstream ENSMUSE00000423475 Chr16:31261316..31261393 GGTGACGATGAAGACGCCTA Chr16:31261367..31261386 61.21 55

*** Putative Vector Insertion (Chr 16: 31260755 - 31261315) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000423470 Chr16:31260660..31260754 CTCCCGAGTCCGATACTTTG Chr16:31260687..31260706 59.69 55
downstream ENSMUSE00000423462 Chr16:31258423..31258590 TTCATGCTGTCTCCATCTGC Chr16:31258421..31258440 59.95 50
downstream ENSMUSE00000702118 Chr16:31258061..31258590 AGCACAGGAGGCACTGTCTT Chr16:31258335..31258354 60.06 55
downstream ENSMUSE00000339230 Chr16:31251627..31254819 ACCCACCTCCATGGTTACAA Chr16:31252200..31252219 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAACATTAATCGCCTTGCAG Chr16:31261250..31261271 59.27 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAAAGCTAAAACATCGTGA Chr16:31261259..31261280 59.5 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047714