Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16207
Trapped Gene
Ccnb1 (ENSMUSG00000041431)
Vector Insertion
Chr 13: 101555574 - 101555687
Public Clones PST23593-NR (escells)
Private Clones OST465144 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000506016 (Chr13:101555688..101555858 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCAAGAGTGCCTCTGAAA Chr13:101555691..101555710 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000506016 (Chr13:101555688..101555858 -)
Downstram Exon
ENSMUSE00000492616 (Chr13:101555412..101555573 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCAAGAGTGCCTCTGAAA Chr13:101555691..101555710 60.13 50 CAGCAAGTTCCACCTCTGGT Chr13:101555455..101555474 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679930 Chr13:101556337..101556451 ATCGGGGAACCTCTGATTTT Chr13:101556367..101556386 59.77 45
upstream ENSMUSE00000506016 Chr13:101555688..101555858 AGGCAAGAGTGCCTCTGAAA Chr13:101555691..101555710 60.13 50

*** Putative Vector Insertion (Chr 13: 101555574 - 101555687) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000492616 Chr13:101555412..101555573 CAGCAAGTTCCACCTCTGGT Chr13:101555455..101555474 60.3 55
downstream ENSMUSE00000491666 Chr13:101553420..101553602 GCGTCTACGTCACTCACTGC Chr13:101553471..101553490 59.65 60
downstream ENSMUSE00000518252 Chr13:101551580..101551738 GCATGAACCGATCAATAATGG Chr13:101551560..101551580 60.17 42.86
downstream ENSMUSE00000520226 Chr13:101551113..101551349 GCTCTACGGAGGAAGTGCAG Chr13:101551107..101551126 60.16 60
downstream ENSMUSE00000519338 Chr13:101550731..101550871 GCAAAATGCACCATGTCGTA Chr13:101550773..101550792 60.53 45
downstream ENSMUSE00000496967 Chr13:101549977..101550087 CAGGTGCTGCATAACAGGAA Chr13:101550000..101550019 59.86 50
downstream ENSMUSE00000569255 Chr13:101548702..101549740 ACTTGGGGGCAAATTCTTTT Chr13:101549112..101549131 59.81 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr13:101555617..101555637 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCAATTAACCTGCGTGACT Chr13:101555629..101555649 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr13:101555789..101555809 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCGTGGACCCTTTTCAAGTT Chr13:101555876..101555896 61.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041431