Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16210
Trapped Gene
Slc30a6 (ENSMUSG00000024069)
Vector Insertion
Chr 17: 74795009 - 74801251
Public Clones (ggtc) 5SE223C04 (ggtc) (ggtc) 3SE223C04 (ggtc) (ggtc)
IST11013B8 (tigm) IST14523C5 (tigm) IST15056E4 (tigm)
Private Clones OST465100 (lexicon) OST450404 (lexicon) OST170804 (lexicon) OST34406 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692249 (Chr17:74794972..74795008 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGTACGGCTCCTTACCAT Chr17:74794988..74795007 59.22 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692249 (Chr17:74794972..74795008 +)
Downstram Exon
ENSMUSE00000383604 (Chr17:74801252..74801338 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGTACGGCTCCTTACCAT Chr17:74794988..74795007 59.22 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692249 Chr17:74794972..74795008 GCTGTACGGCTCCTTACCAT Chr17:74794988..74795007 59.22 55

*** Putative Vector Insertion (Chr 17: 74795009 - 74801251) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383604 Chr17:74801252..74801338 No primer for this exon
downstream ENSMUSE00000394914 Chr17:74803344..74803428 TTGATTGCACCGAACAGAAG Chr17:74803378..74803397 59.84 45
downstream ENSMUSE00000369221 Chr17:74805025..74805067 No primer for this exon
downstream ENSMUSE00000413190 Chr17:74806561..74806626 AGACAGGGCTAGGTTTCCTCA Chr17:74806618..74806638 60.25 52.38
downstream ENSMUSE00000367165 Chr17:74808186..74808266 CCCAATTGTGCCAAGACAGT Chr17:74808245..74808264 60.95 50
downstream ENSMUSE00000338492 Chr17:74808693..74808728 No primer for this exon
downstream ENSMUSE00000375948 Chr17:74809674..74809768 GCATCGTGAACAGGTTGAAA Chr17:74809732..74809751 59.7 45
downstream ENSMUSE00000335967 Chr17:74811614..74811662 TCCTGAAGCCAGCTCGTACT Chr17:74811641..74811660 60.16 55
downstream ENSMUSE00000137945 Chr17:74811947..74812066 CTGGGATAAGGCCACACAAG Chr17:74811969..74811988 60.51 55
downstream ENSMUSE00000137950 Chr17:74814960..74815062 TACATGGTGCCAAACGTCAT Chr17:74815028..74815047 59.85 45
downstream ENSMUSE00000137948 Chr17:74817960..74818007 No primer for this exon
downstream ENSMUSE00000137946 Chr17:74818872..74818940 CTAGCACCCCATCCAAGGTA Chr17:74818899..74818918 59.95 55
downstream ENSMUSE00000656979 Chr17:74822357..74823569 AAGGACCATTTGTTCGTTCG Chr17:74822413..74822432 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGACATTCTCTCCCGTTC Chr17:74798015..74798035 59.81 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGACATTCTCTCCCGTTC Chr17:74798015..74798035 59.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024069