Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16224
Trapped Gene
Mapbpip (ENSMUSG00000028062)
Vector Insertion
Chr 3: 88354708 - 88356276
Public Clones (ggtc) CMHD-GT_503B2-3 (cmhd) IST10897C6 (tigm) IST12457G8 (tigm)
IST11918G2 (tigm)
Private Clones OST464960 (lexicon) OST348671 (lexicon) OST217327 (lexicon) OST188691 (lexicon)
OST69121 (lexicon) OST57006 (lexicon) OST37280 (lexicon) OST26086 (lexicon)
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000712689 (Chr3:88356277..88356439 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAACCAAGCGTTTAATGA Chr3:88356311..88356330 59.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000712689 (Chr3:88356277..88356439 -)
Downstram Exon
ENSMUSE00000175605 (Chr3:88354618..88354707 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAACCAAGCGTTTAATGA Chr3:88356311..88356330 59.94 45 TTGAGCATTCCGAAGCCTAC Chr3:88354603..88354622 60.35 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000395088 Chr3:88356718..88356844 GGTGCAGGTCAGGGTTAAGA Chr3:88356795..88356814 60.11 55
upstream ENSMUSE00000719880 Chr3:88356652..88356781 CAGAGCACCCTGTGAGTGAA Chr3:88356709..88356728 60.02 55
upstream ENSMUSE00000175602 Chr3:88356277..88356439 GGGAACCAAGCGTTTAATGA Chr3:88356311..88356330 59.94 45
upstream ENSMUSE00000712689 Chr3:88356277..88356439 GGGAACCAAGCGTTTAATGA Chr3:88356311..88356330 59.94 45

*** Putative Vector Insertion (Chr 3: 88354708 - 88356276) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175605 Chr3:88354618..88354707 TTGAGCATTCCGAAGCCTAC Chr3:88354603..88354622 60.35 50
downstream ENSMUSE00000175603 Chr3:88353742..88353926 CCATCACGCTGTTATGATGC Chr3:88353837..88353856 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATGGACTGCATGGTATGG Chr3:88356269..88356289 60.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATGGACTGCATGGTATGG Chr3:88356269..88356289 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGCTGAATAATGAGGGATCG Chr3:88356416..88356437 59.68 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028062