Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1623
Trapped Gene
Tle4 (ENSMUSG00000024642)
Vector Insertion
Chr 19: 14542762 - 14590848
Public Clones AZ0160 (sanger) (sanger) AK0456 (sanger) CMHD-GT_495F9-3 (cmhd) CMHD-GT_493H3-3 (cmhd)
CMHD-GT_495H2-3 (cmhd) CMHD-GT_474C6-3 (cmhd)
Private Clones OST451138 (lexicon) OST314459 (lexicon) OST59267 (lexicon) OST59266 (lexicon)
OST44668 (lexicon) OST42945 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000693631 (Chr19:14590849..14590865 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000693631 (Chr19:14590849..14590865 -)
Downstram Exon
ENSMUSE00000547675 (Chr19:14542642..14542761 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAAACTGGCTGATGGGGATA Chr19:14542710..14542729 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000324705 Chr19:14671858..14672473 GTGGTGTTCGCAGAGTTTGA Chr19:14672435..14672454 59.88 50
upstream ENSMUSE00000324695 Chr19:14671247..14671344 GCCTGCTCAACCCTTCAAAT Chr19:14671314..14671333 61.51 50
upstream ENSMUSE00000143959 Chr19:14670080..14670143 GCCAGCGAGAAGACAGAGAT Chr19:14670099..14670118 59.71 55
upstream ENSMUSE00000547755 Chr19:14668874..14668918 No primer for this exon
upstream ENSMUSE00000143948 Chr19:14638879..14638941 GCACAGGTCATTCCTTTCCT Chr19:14638889..14638908 59.14 50
upstream ENSMUSE00000547744 Chr19:14619278..14619352 TGACCATGGCAGAACTGAAC Chr19:14619290..14619309 59.68 50
upstream ENSMUSE00000642704 Chr19:14592262..14592463 CAACAACTCCAAGCTCAGCA Chr19:14592444..14592463 60.17 50
upstream ENSMUSE00000693631 Chr19:14590849..14590865 No primer for this exon

*** Putative Vector Insertion (Chr 19: 14542762 - 14590848) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000547675 Chr19:14542642..14542761 GAAACTGGCTGATGGGGATA Chr19:14542710..14542729 59.89 50
downstream ENSMUSE00000547731 Chr19:14541670..14541723 No primer for this exon
downstream ENSMUSE00000143962 Chr19:14541039..14541191 GTCTTGTCCAGGCCATTCTC Chr19:14541108..14541127 59.66 55
downstream ENSMUSE00000143949 Chr19:14539776..14539908 GGGTAGGTGCATCAGTTCGT Chr19:14539820..14539839 60 55
downstream ENSMUSE00000143957 Chr19:14539234..14539427 CTGGTCAGCTCTCCGTTCAT Chr19:14539312..14539331 60.41 55
downstream ENSMUSE00000143943 Chr19:14538799..14538875 CCTCCTGGAATGCCTGTTAG Chr19:14538783..14538802 59.69 55
downstream ENSMUSE00000371594 Chr19:14529231..14529480 GACCTTAACACAGCCCTTGC Chr19:14529263..14529282 59.74 55
downstream ENSMUSE00000693616 Chr19:14528197..14528207 No primer for this exon
downstream ENSMUSE00000547711 Chr19:14528069..14528316 ATTAAGGTGCGACCATCAGG Chr19:14528239..14528258 59.96 50
downstream ENSMUSE00000693615 Chr19:14528069..14528116 GATCCCACACTGCGATGTTA Chr19:14528069..14528088 59.53 50
downstream ENSMUSE00000143947 Chr19:14526910..14527057 TGTTGTCCAAACCACCTGTC Chr19:14526950..14526969 59.42 50
downstream ENSMUSE00000547696 Chr19:14526554..14526704 GGCAATAGCCCAATGAAAAG Chr19:14526661..14526680 59.55 45
downstream ENSMUSE00000547693 Chr19:14526133..14526209 GAATATGCTGGCCCCATAAG Chr19:14526114..14526133 59.39 50
downstream ENSMUSE00000706838 Chr19:14522640..14524331 GAGGGGTGGAGCATCAAATA Chr19:14523824..14523843 59.89 50
downstream ENSMUSE00000412382 Chr19:14522562..14524331 GAGGGGTGGAGCATCAAATA Chr19:14523824..14523843 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAGTGAATAATCGCCTTGC Chr19:14542785..14542806 60.22 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTGAACGTGACTGGGAAAA Chr19:14542783..14542804 59.62 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGTCACTTTTAATCGCCTTGC Chr19:14584803..14584824 60.26 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGTGACCTCAGACCAAATCT Chr19:14575828..14575849 59.56 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024642