Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16235
Trapped Gene
Ramp3 (ENSMUSG00000041046)
Vector Insertion
Chr 11: 6558631 - 6574765
Public Clones not available
Private Clones OST464697 (lexicon) OST188192 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000377048 (Chr11:6558568..6558630 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGCACCTTCTTCCACTGT Chr11:6558596..6558615 60.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000377048 (Chr11:6558568..6558630 +)
Downstram Exon
ENSMUSE00000258924 (Chr11:6574766..6574898 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGCACCTTCTTCCACTGT Chr11:6558596..6558615 60.45 55 AGGTTGCACCACTTCCAGAC Chr11:6574886..6574905 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377048 Chr11:6558568..6558630 GCTGCACCTTCTTCCACTGT Chr11:6558596..6558615 60.45 55

*** Putative Vector Insertion (Chr 11: 6558631 - 6574765) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000258924 Chr11:6574766..6574898 AGGTTGCACCACTTCCAGAC Chr11:6574886..6574905 60.16 55
downstream ENSMUSE00000405033 Chr11:6576486..6577475 ACACGTGGCTCCTAATGACC Chr11:6577260..6577279 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCCCACAAGGTGTGGTTA Chr11:6567643..6567663 59.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCCCACAAGGTGTGGTTA Chr11:6567643..6567663 59.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041046