Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1624
Trapped Gene
Smtnl2 (ENSMUSG00000045667)
Vector Insertion
Chr 11: 72217507 - 72224745
Public Clones AZ0140 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000336091 (Chr11:72224746..72225000 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCAGTCATGCCACCTTTT Chr11:72224766..72224785 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000336091 (Chr11:72224746..72225000 -)
Downstram Exon
ENSMUSE00000578569 (Chr11:72217429..72217506 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCAGTCATGCCACCTTTT Chr11:72224766..72224785 60.11 50 TGGTGTCCGTTCTCCAAGAT Chr11:72217408..72217427 60.51 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353101 Chr11:72225003..72225083 No primer for this exon
upstream ENSMUSE00000336091 Chr11:72224746..72225000 CTCCAGTCATGCCACCTTTT Chr11:72224766..72224785 60.11 50
upstream ENSMUSE00000403308 Chr11:72224746..72225215 CTGCGGATCTCTCAACGTCT Chr11:72225179..72225198 60.56 55
upstream ENSMUSE00000676974 Chr11:72224746..72225213 CTGCGGATCTCTCAACGTCT Chr11:72225179..72225198 60.56 55

*** Putative Vector Insertion (Chr 11: 72217507 - 72224745) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000578569 Chr11:72217429..72217506 TGGTGTCCGTTCTCCAAGAT Chr11:72217408..72217427 60.51 50
downstream ENSMUSE00000578575 Chr11:72217419..72217506 TGGTGTCCGTTCTCCAAGAT Chr11:72217408..72217427 60.51 50
downstream ENSMUSE00000676972 Chr11:72217419..72217426 No primer for this exon
downstream ENSMUSE00000578574 Chr11:72216513..72216752 GACGAGGTTTGGACCTCAGA Chr11:72216694..72216713 60.24 55
downstream ENSMUSE00000588116 Chr11:72216513..72216752 GACGAGGTTTGGACCTCAGA Chr11:72216694..72216713 60.24 55
downstream ENSMUSE00000578573 Chr11:72215927..72216002 AGCCAGACAAAGACCGAGTG Chr11:72215945..72215964 60.44 55
downstream ENSMUSE00000588115 Chr11:72215927..72216002 AGCCAGACAAAGACCGAGTG Chr11:72215945..72215964 60.44 55
downstream ENSMUSE00000578572 Chr11:72214850..72215029 CTTCTCAAACAGCGCCTTTC Chr11:72214851..72214870 60.13 50
downstream ENSMUSE00000588114 Chr11:72214850..72215029 CTTCTCAAACAGCGCCTTTC Chr11:72214851..72214870 60.13 50
downstream ENSMUSE00000578571 Chr11:72213831..72213948 CCACACCGAAACTCTGTGAC Chr11:72213874..72213893 59.15 55
downstream ENSMUSE00000588113 Chr11:72213831..72213948 CCACACCGAAACTCTGTGAC Chr11:72213874..72213893 59.15 55
downstream ENSMUSE00000578570 Chr11:72213376..72213527 GGAGAAATTCTGCAGGTCCA Chr11:72213482..72213501 60.19 50
downstream ENSMUSE00000588112 Chr11:72213376..72213527 GGAGAAATTCTGCAGGTCCA Chr11:72213482..72213501 60.19 50
downstream ENSMUSE00000363294 Chr11:72203616..72204915 TGGTTGTAGAGCGACTGCAC Chr11:72204786..72204805 60.06 55
downstream ENSMUSE00000588111 Chr11:72203616..72204915 TGGTTGTAGAGCGACTGCAC Chr11:72204786..72204805 60.06 55
downstream ENSMUSE00000676973 Chr11:72202666..72204915 TGGTTGTAGAGCGACTGCAC Chr11:72204786..72204805 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCAGTCATGCCACCTTTT Chr11:72218764..72218784 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCAGTCATGCCACCTTTT Chr11:72218764..72218784 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045667