Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16256
Trapped Gene
Tmem27 (ENSMUSG00000015401)
Vector Insertion
Chr X: 160528118 - 160528263
Public Clones not available
Private Clones OST464441 (lexicon) OST117705 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691041 (ChrX:160528086..160528262 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691041 (ChrX:160528086..160528262 +)
Downstram Exon
ENSMUSE00000711078 (ChrX:160528119..160528262 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691042 ChrX:160526762..160526854 No primer for this exon
upstream ENSMUSE00000691041 ChrX:160528086..160528262 No primer for this exon

*** Putative Vector Insertion (Chr X: 160528118 - 160528263) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000711078 ChrX:160528119..160528262 No primer for this exon
downstream ENSMUSE00000712739 ChrX:160528119..160528262 No primer for this exon
downstream ENSMUSE00000208724 ChrX:160528621..160528679 No primer for this exon
downstream ENSMUSE00000691035 ChrX:160528621..160528679 No primer for this exon
downstream ENSMUSE00000208727 ChrX:160532808..160532893 No primer for this exon
downstream ENSMUSE00000691034 ChrX:160532808..160532893 No primer for this exon
downstream ENSMUSE00000208728 ChrX:160543908..160544021 No primer for this exon
downstream ENSMUSE00000208729 ChrX:160546257..160546451 No primer for this exon
downstream ENSMUSE00000208722 ChrX:160556128..160556791 No primer for this exon
downstream ENSMUSE00000691040 ChrX:160556128..160556792 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCCTAATCCGGGTCACAG ChrX:160528111..160528131 59.81 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCCTAATCCGGGTCACAG ChrX:160528111..160528131 59.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015401