Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16257
Trapped Gene
Tmem202 (ENSMUSG00000049526)
Vector Insertion
Chr 9: 59368046 - 59372524
Public Clones not available
Private Clones OST464439 (lexicon) OST390124 (lexicon) OST369874 (lexicon) OST176015 (lexicon)
OST109517 (lexicon) OST98245 (lexicon)
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000346643 (Chr9:59372525..59372771 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTTCCTACCAACCAACAA Chr9:59372748..59372767 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000346643 (Chr9:59372525..59372771 -)
Downstram Exon
ENSMUSE00000364992 (Chr9:59367896..59368045 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTTCCTACCAACCAACAA Chr9:59372748..59372767 59.82 50 AGATCCAACTCAGCGGACAT Chr9:59367903..59367922 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358576 Chr9:59373172..59373308 GAGACAAATTCCGTGGCAGT Chr9:59373274..59373293 60.12 50
upstream ENSMUSE00000346643 Chr9:59372525..59372771 CCCTTCCTACCAACCAACAA Chr9:59372748..59372767 59.82 50

*** Putative Vector Insertion (Chr 9: 59368046 - 59372524) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000364992 Chr9:59367896..59368045 AGATCCAACTCAGCGGACAT Chr9:59367903..59367922 59.69 50
downstream ENSMUSE00000410553 Chr9:59367426..59367557 GAAACAGGTTGAGGCAGAGG Chr9:59367503..59367522 59.84 55
downstream ENSMUSE00000356838 Chr9:59366493..59367081 CTGACGTCCCATCTCCTCAT Chr9:59366536..59366555 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCATGAGCTGTGCTGGAG Chr9:59369543..59369563 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCATGAGCTGTGCTGGAG Chr9:59369543..59369563 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049526