Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16260
Trapped Gene
Actn2 (ENSMUSG00000052374)
Vector Insertion
Chr 13: 12398629 - 12401166
Public Clones IST13931B7 (tigm)
Private Clones OST464414 (lexicon) OST455157 (lexicon) OST440995 (lexicon) OST342360 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000571895 (Chr13:12401167..12401253 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCCTGGGTATGATCTGGA Chr13:12401209..12401228 59.74 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000571895 (Chr13:12401167..12401253 -)
Downstram Exon
ENSMUSE00000571894 (Chr13:12398541..12398628 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCCTGGGTATGATCTGGA Chr13:12401209..12401228 59.74 55 CCTCTGACACCATAGCAGCA Chr13:12398566..12398585 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000342528 Chr13:12432642..12432999 CGGCGTGCAGTACAACTATG Chr13:12432731..12432750 60.34 55
upstream ENSMUSE00000711006 Chr13:12432642..12432999 CGGCGTGCAGTACAACTATG Chr13:12432731..12432750 60.34 55
upstream ENSMUSE00000571897 Chr13:12403114..12403228 GCACCCAGATCGAGAACATC Chr13:12403169..12403188 60.63 55
upstream ENSMUSE00000571896 Chr13:12401862..12401981 TCCACAAGATTGCGAATGTC Chr13:12401923..12401942 59.65 45
upstream ENSMUSE00000571895 Chr13:12401167..12401253 GACCCTGGGTATGATCTGGA Chr13:12401209..12401228 59.74 55
upstream ENSMUSE00000684611 Chr13:12400486..12401253 AAAAGACCGAGGCAGTGCTA Chr13:12400995..12401014 60.01 50

*** Putative Vector Insertion (Chr 13: 12398629 - 12401166) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000571894 Chr13:12398541..12398628 CCTCTGACACCATAGCAGCA Chr13:12398566..12398585 60.01 55
downstream ENSMUSE00000571893 Chr13:12396581..12396659 ATGAGGGCACAGAGTCCAAG Chr13:12396605..12396624 60.26 55
downstream ENSMUSE00000571892 Chr13:12393202..12393283 TCCATGGCCAGGTTAATGTT Chr13:12393227..12393246 60.19 45
downstream ENSMUSE00000571891 Chr13:12388742..12388827 CTTTCATCGGGTTTGGGAGT Chr13:12388775..12388794 61.24 50
downstream ENSMUSE00000298103 Chr13:12386577..12386669 TTCCATCAGCCTCTCATTCTC Chr13:12386579..12386599 59.38 47.62
downstream ENSMUSE00000571890 Chr13:12383927..12384157 CTTCTCAGGCGTCCTGTTCT Chr13:12384079..12384098 59.6 55
downstream ENSMUSE00000114863 Chr13:12382941..12383088 CGCTCCAGTCTTCGAATCTC Chr13:12382981..12383000 60.1 55
downstream ENSMUSE00000571889 Chr13:12380774..12380924 CGCAGACTCGTAGTCCTTCTG Chr13:12380862..12380882 60.2 57.14
downstream ENSMUSE00000116667 Chr13:12374782..12374890 CACCGATCATTGACGTTCAC Chr13:12374827..12374846 59.97 50
downstream ENSMUSE00000571888 Chr13:12372696..12372836 ATCTCCTCGATGCTGTGGAC Chr13:12372678..12372697 60.23 55
downstream ENSMUSE00000298063 Chr13:12371061..12371243 ACAGTGCTGTAGGGGTTGCT Chr13:12371073..12371092 59.79 55
downstream ENSMUSE00000298054 Chr13:12369666..12369800 GACGCTCATTAGCATGTTGG Chr13:12369706..12369725 59.3 50
downstream ENSMUSE00000571887 Chr13:12368630..12368809 CCATGGTGTAGTTCGTGTGC Chr13:12368610..12368629 60.03 55
downstream ENSMUSE00000571886 Chr13:12367345..12367491 TGGGTCTCCACCTCATTGAT Chr13:12367402..12367421 60.33 50
downstream ENSMUSE00000116672 Chr13:12364966..12365031 CATAGCCCATGGAAATGAGG Chr13:12364949..12364968 60.29 50
downstream ENSMUSE00000571885 Chr13:12363045..12363203 TTGGGGTCAACCAAAGTCAT Chr13:12363138..12363157 60.21 45
downstream ENSMUSE00000406318 Chr13:12361696..12361919 CTCTCGACGAAGCTCCTCTG Chr13:12361865..12361884 60.42 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTGGTCCACGTGTCTAAT Chr13:12401132..12401152 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACCGTGACTGGGAAAACC Chr13:12401099..12401119 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTTTTCTCGCCCACAGAAAT Chr13:12401248..12401268 59.69 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTTTCTCGCCCACAGAAAT Chr13:12401248..12401268 59.69 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052374