Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16274
Trapped Gene
Tbc1d24 (ENSMUSG00000036473)
Vector Insertion
Chr 17: 24326999 - 24342418
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) E123D03 (ggtc)
E037G05 (ggtc) IST14910E3 (tigm) IST14651F6 (tigm) IST12841G10 (tigm)
IST14157D4 (tigm) IST14329D3 (tigm) IST13613H9 (tigm) IST14162E8 (tigm)
IST10456E5 (tigm) IST14848D1 (tigm) IST14632D7 (tigm) IST14480H12 (tigm)
IST13613B5 (tigm)
Private Clones OST464296 (lexicon) OST333162 (lexicon) OST292593 (lexicon) OST276694 (lexicon)
OST227233 (lexicon) OST223782 (lexicon) OST223185 (lexicon) OST221317 (lexicon)
OST81518 (lexicon) OST61278 (lexicon) OST57720 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000482671 (Chr17:24342419..24342505 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAAGTCCAGTGCGGTCCAG Chr17:24342458..24342477 63.14 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000482671 (Chr17:24342419..24342505 -)
Downstram Exon
ENSMUSE00000397195 (Chr17:24326889..24326998 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAAGTCCAGTGCGGTCCAG Chr17:24342458..24342477 63.14 60 GTCACAGGGGTCCACTTCAG Chr17:24326901..24326920 60.56 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000482671 Chr17:24342419..24342505 GAAAGTCCAGTGCGGTCCAG Chr17:24342458..24342477 63.14 60

*** Putative Vector Insertion (Chr 17: 24326999 - 24342418) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000397195 Chr17:24326889..24326998 GTCACAGGGGTCCACTTCAG Chr17:24326901..24326920 60.56 60
downstream ENSMUSE00000475486 Chr17:24322149..24323232 TCAGGCAAGGGCAGACTACT Chr17:24322811..24322830 60.01 55
downstream ENSMUSE00000658078 Chr17:24321326..24321343 No primer for this exon
downstream ENSMUSE00000401365 Chr17:24320639..24320797 AGGGATCCAGGACCAAATGT Chr17:24320685..24320704 60.58 50
downstream ENSMUSE00000309806 Chr17:24319731..24319794 GGGCTCATGTCCTTCACACT Chr17:24319742..24319761 60.12 55
downstream ENSMUSE00000309780 Chr17:24319395..24319490 GTCCTCTCGCTCCAGTCTGT Chr17:24319428..24319447 59.58 60
downstream ENSMUSE00000309759 Chr17:24318701..24318929 ACTTGAGGGATGTTGCCTTG Chr17:24318832..24318851 60.11 50
downstream ENSMUSE00000612131 Chr17:24318170..24318340 ACAGCTGCGATGAGGAAGTT Chr17:24318201..24318220 60.02 50
downstream ENSMUSE00000658081 Chr17:24312377..24317621 GACTCAGAACGGAGGCAGTC Chr17:24316239..24316258 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAGCACTTAGAGCCAACA Chr17:24330400..24330420 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAATGGGCAGTGTCACAGG Chr17:24336397..24336417 61.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CATCCAGCACCCCATCTTTA Chr17:24336508..24336528 60.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAAAGTCCAGTGCGGTCCAG Chr17:24336456..24336476 63.14 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036473