Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16281
Trapped Gene
Gle1 (ENSMUSG00000019715)
Vector Insertion
Chr 2: 29791119 - 29791529
Public Clones IST14121D8 (tigm)
Private Clones OST464155 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000287585 (Chr2:29790977..29791118 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000287585 (Chr2:29790977..29791118 +)
Downstram Exon
ENSMUSE00000162781 (Chr2:29791530..29791757 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000287585 Chr2:29790977..29791118 No primer for this exon

*** Putative Vector Insertion (Chr 2: 29791119 - 29791529) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000162781 Chr2:29791530..29791757 No primer for this exon
downstream ENSMUSE00000162799 Chr2:29794015..29794125 No primer for this exon
downstream ENSMUSE00000162800 Chr2:29794655..29794803 No primer for this exon
downstream ENSMUSE00000162791 Chr2:29795003..29795063 No primer for this exon
downstream ENSMUSE00000287543 Chr2:29795602..29795856 No primer for this exon
downstream ENSMUSE00000287532 Chr2:29798058..29798286 No primer for this exon
downstream ENSMUSE00000162792 Chr2:29799245..29799357 No primer for this exon
downstream ENSMUSE00000162795 Chr2:29799509..29799578 No primer for this exon
downstream ENSMUSE00000287493 Chr2:29804410..29804552 No primer for this exon
downstream ENSMUSE00000287469 Chr2:29804676..29804866 No primer for this exon
downstream ENSMUSE00000287461 Chr2:29806122..29806251 No primer for this exon
downstream ENSMUSE00000287453 Chr2:29808075..29808179 No primer for this exon
downstream ENSMUSE00000419878 Chr2:29811126..29811208 No primer for this exon
downstream ENSMUSE00000162787 Chr2:29813270..29813333 No primer for this exon
downstream ENSMUSE00000646209 Chr2:29813967..29814942 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr2:29791169..29791189 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTTTAGCAGGCTCCCTAGT Chr2:29791142..29791162 58.63 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019715