Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16290
Trapped Gene
Usp28 (ENSMUSG00000032267)
Vector Insertion
Chr 9: 48793643 - 48808454
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) D107B03 (ggtc) E061C01 (ggtc) (ggtc)
(ggtc) E027D10 (ggtc) (ggtc) IST14325A4 (tigm) IST14898E12 (tigm)
IST12262F4 (tigm)
Private Clones OST463975 (lexicon) OST297183 (lexicon) OST271322 (lexicon) OST66123 (lexicon)
OST53733 (lexicon) OST33244 (lexicon) OST30712 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000479060 (Chr9:48793490..48793642 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACAACGAGAGTGGGGCTAC Chr9:48793545..48793564 59.73 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000479060 (Chr9:48793490..48793642 +)
Downstram Exon
ENSMUSE00000699592 (Chr9:48808455..48808533 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACAACGAGAGTGGGGCTAC Chr9:48793545..48793564 59.73 60 GATCCTGGATGCCTGTGATT Chr9:48808510..48808529 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479060 Chr9:48793490..48793642 GACAACGAGAGTGGGGCTAC Chr9:48793545..48793564 59.73 60

*** Putative Vector Insertion (Chr 9: 48793643 - 48808454) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699592 Chr9:48808455..48808533 GATCCTGGATGCCTGTGATT Chr9:48808510..48808529 59.89 50
downstream ENSMUSE00000478045 Chr9:48808456..48808533 GATCCTGGATGCCTGTGATT Chr9:48808510..48808529 59.89 50
downstream ENSMUSE00000502520 Chr9:48809613..48809745 AGCAGTTGTGTCGTGACTGG Chr9:48809696..48809715 59.94 55
downstream ENSMUSE00000699590 Chr9:48809613..48809745 AGCAGTTGTGTCGTGACTGG Chr9:48809696..48809715 59.94 55
downstream ENSMUSE00000247372 Chr9:48811096..48811201 GCCTGCAGGTCATCTTTGTT Chr9:48811141..48811160 60.26 50
downstream ENSMUSE00000699589 Chr9:48811096..48811201 GCCTGCAGGTCATCTTTGTT Chr9:48811141..48811160 60.26 50
downstream ENSMUSE00000247816 Chr9:48811928..48812087 CCCAAACTTCACAGCGTTTT Chr9:48811992..48812011 60.15 45
downstream ENSMUSE00000699587 Chr9:48811928..48812087 CCCAAACTTCACAGCGTTTT Chr9:48811992..48812011 60.15 45
downstream ENSMUSE00000247793 Chr9:48816534..48816620 AGGATGTTCTGTGGCAGGTT Chr9:48816601..48816620 59.58 50
downstream ENSMUSE00000699586 Chr9:48816534..48816620 AGGATGTTCTGTGGCAGGTT Chr9:48816601..48816620 59.58 50
downstream ENSMUSE00000247768 Chr9:48817201..48817338 TGATCCCAACAACAGAGCAA Chr9:48817266..48817285 60.24 45
downstream ENSMUSE00000699584 Chr9:48817201..48817338 TGATCCCAACAACAGAGCAA Chr9:48817266..48817285 60.24 45
downstream ENSMUSE00000501591 Chr9:48818348..48818421 ATCCAGGAGCTTGTGTGTGA Chr9:48818386..48818405 59.26 50
downstream ENSMUSE00000699583 Chr9:48818348..48818421 ATCCAGGAGCTTGTGTGTGA Chr9:48818386..48818405 59.26 50
downstream ENSMUSE00000342673 Chr9:48819368..48819447 GCACCATGGGATTTTCAGAT Chr9:48819408..48819427 59.76 45
downstream ENSMUSE00000699582 Chr9:48819368..48819447 GCACCATGGGATTTTCAGAT Chr9:48819408..48819427 59.76 45
downstream ENSMUSE00000247710 Chr9:48823207..48823355 AGAGGATACTGGCCGAAGGT Chr9:48823252..48823271 60.1 55
downstream ENSMUSE00000699580 Chr9:48823207..48823355 AGAGGATACTGGCCGAAGGT Chr9:48823252..48823271 60.1 55
downstream ENSMUSE00000247685 Chr9:48824787..48824914 AACACTGGAGGCAGCTTTGT Chr9:48824818..48824837 59.91 50
downstream ENSMUSE00000247673 Chr9:48826477..48826572 TCAACTTCCGAACGCTCTCT Chr9:48826538..48826557 60.13 50
downstream ENSMUSE00000247649 Chr9:48832011..48832190 CACCGAGGGAAGTGGTAATG Chr9:48832158..48832177 60.37 55
downstream ENSMUSE00000247343 Chr9:48833873..48834093 CTGGGAAGAGCATCTTCTGG Chr9:48833944..48833963 59.94 55
downstream ENSMUSE00000247181 Chr9:48834924..48834994 TCGTGCTGCTCGAGATACAG Chr9:48834956..48834975 60.31 55
downstream ENSMUSE00000370627 Chr9:48836178..48836406 GAAGTGGGGCAAGTTGTCAT Chr9:48836402..48836421 59.97 50
downstream ENSMUSE00000408618 Chr9:48838832..48839026 CCTCTTGCTGAAACCTCCAG Chr9:48838939..48838958 59.98 55
downstream ENSMUSE00000247128 Chr9:48840319..48840458 GAAGACAAGCATCGGACCTC Chr9:48840364..48840383 59.81 55
downstream ENSMUSE00000369001 Chr9:48840614..48840793 TTCTTGGGCTCAGCTTCATT Chr9:48840639..48840658 59.96 45
downstream ENSMUSE00000247286 Chr9:48841682..48841777 AAAGGTCTGGCGTGCTTTAG Chr9:48841747..48841766 59.52 50
downstream ENSMUSE00000247573 Chr9:48843698..48843876 CTACCCTCTTGGGTGCTTCA Chr9:48843824..48843843 60.25 55
downstream ENSMUSE00000247549 Chr9:48843987..48844065 TTCCATCAATTTGGCCTGAG Chr9:48844032..48844051 60.97 45
downstream ENSMUSE00000218240 Chr9:48845282..48845361 GGCCCGTTAGAAGGTACACA Chr9:48845342..48845361 59.99 55
downstream ENSMUSE00000218242 Chr9:48845873..48845996 TGCGGTATAAGGCAATCACA Chr9:48845985..48846004 60.1 45
downstream ENSMUSE00000218239 Chr9:48847087..48847282 GTCGTCCTTGGAGATGTCGT Chr9:48847224..48847243 60.12 55
downstream ENSMUSE00000350328 Chr9:48849479..48850622 CAGACACCCAATCCCTCTGT Chr9:48849760..48849779 59.96 55
downstream ENSMUSE00000699579 Chr9:48849479..48850615 CAGACACCCAATCCCTCTGT Chr9:48849760..48849779 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr9:48802693..48802713 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAATAACGTGACTGGGAAAACC Chr9:48802687..48802710 59.32 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032267