Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16292
Trapped Gene
Chn2 (ENSMUSG00000004633)
Vector Insertion
Chr 6: 53990150 - 54123457
Public Clones IST10800B5 (tigm) IST14744C4 (tigm) IST12660C4 (tigm) IST14984G3 (tigm)
IST10800B5 (tigm) IST11633B3 (tigm) IST14984G3 (tigm) IST12063D7 (tigm)
IST11067E1 (tigm) IST13763G8 (tigm) IST12443H7 (tigm)
Private Clones OST463943 (lexicon) OST373099 (lexicon) OST367478 (lexicon) OST316168 (lexicon)
OST279530 (lexicon) OST206915 (lexicon) OST188291 (lexicon) OST148244 (lexicon)
OST136628 (lexicon) OST55142 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713863 (Chr6:53990033..53990149 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713863 (Chr6:53990033..53990149 +)
Downstram Exon
ENSMUSE00000699206 (Chr6:54123458..54123496 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699207 Chr6:53990033..53990149 No primer for this exon
upstream ENSMUSE00000713863 Chr6:53990033..53990149 No primer for this exon

*** Putative Vector Insertion (Chr 6: 53990150 - 54123457) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699206 Chr6:54123458..54123496 No primer for this exon
downstream ENSMUSE00000699205 Chr6:54144020..54144075 No primer for this exon
downstream ENSMUSE00000616893 Chr6:54165656..54165687 No primer for this exon
downstream ENSMUSE00000616892 Chr6:54168518..54168631 No primer for this exon
downstream ENSMUSE00000616891 Chr6:54170411..54170696 No primer for this exon
downstream ENSMUSE00000699197 Chr6:54171915..54172544 No primer for this exon
downstream ENSMUSE00000699195 Chr6:54215181..54215198 No primer for this exon
downstream ENSMUSE00000699194 Chr6:54219150..54219440 No primer for this exon
downstream ENSMUSE00000654695 Chr6:54222902..54223147 No primer for this exon
downstream ENSMUSE00000483205 Chr6:54223070..54223147 No primer for this exon
downstream ENSMUSE00000561319 Chr6:54236088..54236172 No primer for this exon
downstream ENSMUSE00000561318 Chr6:54240261..54240434 No primer for this exon
downstream ENSMUSE00000192609 Chr6:54243032..54243109 No primer for this exon
downstream ENSMUSE00000561316 Chr6:54245778..54245915 No primer for this exon
downstream ENSMUSE00000192605 Chr6:54248039..54248144 No primer for this exon
downstream ENSMUSE00000401531 Chr6:54250067..54250385 No primer for this exon
downstream ENSMUSE00000616834 Chr6:54250067..54250715 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGTCCATAGGCGCAGAAG Chr6:54017120..54017140 60.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGTCCATAGGCGCAGAAG Chr6:54017120..54017140 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004633