Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16295
Trapped Gene
Arfip1 (ENSMUSG00000074513)
Vector Insertion
Chr 3: 84351958 - 84386335
Public Clones IST11406D9 (tigm) IST14210A5 (tigm) IST14441F12 (tigm)
Private Clones OST463870 (lexicon) OST170394 (lexicon) OST145227 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674131 (Chr3:84386336..84386547 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGGAGACGAAGGAAAAGC Chr3:84386444..84386463 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674131 (Chr3:84386336..84386547 -)
Downstram Exon
ENSMUSE00000674130 (Chr3:84351856..84351957 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGGAGACGAAGGAAAAGC Chr3:84386444..84386463 60.33 55 TGAGCATCGTCAACTTCTCC Chr3:84351853..84351872 58.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674131 Chr3:84386336..84386547 GGAGGAGACGAAGGAAAAGC Chr3:84386444..84386463 60.33 55

*** Putative Vector Insertion (Chr 3: 84351958 - 84386335) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000674130 Chr3:84351856..84351957 TGAGCATCGTCAACTTCTCC Chr3:84351853..84351872 58.96 50
downstream ENSMUSE00000674129 Chr3:84338509..84338617 CCCCCTCTTTGGTACTGTCA Chr3:84338511..84338530 59.96 55
downstream ENSMUSE00000674128 Chr3:84333092..84333187 TTACTAGCTGCCACCCTGCT Chr3:84333108..84333127 60.04 55
downstream ENSMUSE00000674127 Chr3:84331608..84331720 TGGTCCTCCTTTTGTGTGTG Chr3:84331667..84331686 59.56 50
downstream ENSMUSE00000638632 Chr3:84323404..84323625 GTGTGCACCATCTGGAAAAG Chr3:84323440..84323459 59.14 50
downstream ENSMUSE00000638630 Chr3:84319555..84319712 TAATGGCCCCAAGAAGAGTC Chr3:84319618..84319637 59.13 50
downstream ENSMUSE00000638629 Chr3:84313730..84313904 GCGGTACGCATCATATTCAA Chr3:84313861..84313880 59.55 45
downstream ENSMUSE00000638628 Chr3:84299985..84301813 GCACTGGATTTTCCGTCCTA Chr3:84300458..84300477 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGATGTTGGAAACGGAGT Chr3:84374344..84374364 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACTCGTGACTGGGAAAAC Chr3:84374269..84374289 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGAGCACTTCCTTCCTGCAA Chr3:84374547..84374567 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGAGCACTTCCTTCCTGCAA Chr3:84374547..84374567 60.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074513