Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI163
Trapped Gene
Rbck1 (ENSMUSG00000027466)
Vector Insertion
Chr 2: 152150377 - 152151951
Public Clones GC0159 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000169778 (Chr2:152151952..152152150 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACACGTCACTCAACCCACA Chr2:152151990..152152009 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000169778 (Chr2:152151952..152152150 -)
Downstram Exon
ENSMUSE00000169780 (Chr2:152150261..152150376 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACACGTCACTCAACCCACA Chr2:152151990..152152009 60.05 50 GAGGTCCTTGAAGCCCAAAT Chr2:152150335..152150354 60.44 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000331751 Chr2:152158232..152158371 TCATGGGTCCCTAGACCAAG Chr2:152158321..152158340 59.92 55
upstream ENSMUSE00000382703 Chr2:152157770..152157858 CAGATGGACGAGAAGACCAA Chr2:152157775..152157794 58.8 50
upstream ENSMUSE00000681778 Chr2:152157770..152158148 GCTTCTACCTTCCCGCTCTC Chr2:152157865..152157884 60.48 60
upstream ENSMUSE00000398238 Chr2:152156696..152156840 TGCAAGTAAAACCCGAGGTC Chr2:152156716..152156735 60.11 50
upstream ENSMUSE00000169779 Chr2:152152983..152153076 AGTACGCCCGGATATGACAG Chr2:152153003..152153022 59.98 55
upstream ENSMUSE00000169778 Chr2:152151952..152152150 AACACGTCACTCAACCCACA Chr2:152151990..152152009 60.05 50

*** Putative Vector Insertion (Chr 2: 152150377 - 152151951) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000169780 Chr2:152150261..152150376 GAGGTCCTTGAAGCCCAAAT Chr2:152150335..152150354 60.44 50
downstream ENSMUSE00000169771 Chr2:152150003..152150176 CTTGCACGACAGCACATCTC Chr2:152150078..152150097 60.63 55
downstream ENSMUSE00000169774 Chr2:152148908..152149068 GCCAGCACTGAGTAGCACAC Chr2:152148934..152148953 59.65 60
downstream ENSMUSE00000169775 Chr2:152147896..152148007 GGCATGAGTAGGTGCTGTCA Chr2:152147906..152147925 59.86 55
downstream ENSMUSE00000169781 Chr2:152144860..152145039 CTCAAGGTGCTTCGGTTCTC Chr2:152144944..152144963 59.99 55
downstream ENSMUSE00000169776 Chr2:152144449..152144547 GCCAGGTCGTCTTGGTACTC Chr2:152144479..152144498 59.73 60
downstream ENSMUSE00000169772 Chr2:152144048..152144191 CTGTACAGCGGATCCAGTCA Chr2:152144079..152144098 59.85 55
downstream ENSMUSE00000556181 Chr2:152142074..152142650 AGCTCAGCTGGGTCCTTGTA Chr2:152142379..152142398 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACGATAATCGCCTTGCAG Chr2:152151886..152151906 60.74 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACGACGTGACTGGGAAAAC Chr2:152151885..152151905 60.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027466