Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16301
Trapped Gene
Mobp (ENSMUSG00000032517)
Vector Insertion
Chr 9: 120063884 - 120076918
Public Clones IST12282E9 (tigm) IST12282E9 (tigm) IST14666F4 (tigm)
Private Clones OST463637 (lexicon) OST310056 (lexicon) OST267851 (lexicon) OST194577 (lexicon)
OST115440 (lexicon) OST105773 (lexicon) OST85696 (lexicon) OST48266 (lexicon)
OST26159 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220404 (Chr9:120063805..120063883 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGCAAGACAAGCGGAGAC Chr9:120063824..120063843 59.75 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220404 (Chr9:120063805..120063883 +)
Downstram Exon
ENSMUSE00000349501 (Chr9:120076919..120077128 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGCAAGACAAGCGGAGAC Chr9:120063824..120063843 59.75 55 TGCTCGGAGAACTTCTGGTT Chr9:120076987..120077006 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000582965 Chr9:120058860..120058915 TCCACAGGAACCTTTCACAA Chr9:120058880..120058899 59.11 45
upstream ENSMUSE00000220404 Chr9:120063805..120063883 AGAGCAAGACAAGCGGAGAC Chr9:120063824..120063843 59.75 55

*** Putative Vector Insertion (Chr 9: 120063884 - 120076918) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000349501 Chr9:120076919..120077128 TGCTCGGAGAACTTCTGGTT Chr9:120076987..120077006 59.99 50
downstream ENSMUSE00000633611 Chr9:120077341..120078494 GCCAGCTTGTCTCTTTTTGG Chr9:120078163..120078182 59.99 50
downstream ENSMUSE00000688558 Chr9:120080636..120080651 No primer for this exon
downstream ENSMUSE00000582961 Chr9:120082269..120085209 TGAAACCAAAAGACCCGTTC Chr9:120082590..120082609 59.95 45
downstream ENSMUSE00000633612 Chr9:120089149..120089161 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAATCCCTAGCAGGCATGA Chr9:120066893..120066913 59.67 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAATCCCTAGCAGGCATGA Chr9:120066893..120066913 59.67 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032517