Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16320
Trapped Gene
Ythdf3 (ENSMUSG00000047213)
Vector Insertion
Chr 3: 16105543 - 16113954
Public Clones not available
Private Clones OST463223 (lexicon) OST366981 (lexicon) OST134530 (lexicon)
Severity of mutation (?) Insertion after 99% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676364 (Chr3:16105529..16105542 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676364 (Chr3:16105529..16105542 +)
Downstram Exon
ENSMUSE00000676366 (Chr3:16113955..16116852 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CACACGGTGGTTATTGCTTG Chr3:16113991..16114010 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639941 Chr3:16083250..16083520 CGGGTTACGGTGAAGAATGT Chr3:16083481..16083500 59.85 50
upstream ENSMUSE00000479186 Chr3:16083922..16083946 No primer for this exon
upstream ENSMUSE00000639938 Chr3:16087055..16087115 ACAGAGGAAACAGGCGAAGA Chr3:16087091..16087110 59.99 50
upstream ENSMUSE00000387713 Chr3:16089478..16089563 No primer for this exon
upstream ENSMUSE00000478291 Chr3:16103187..16103219 No primer for this exon
upstream ENSMUSE00000676365 Chr3:16103826..16105431 CCTCACCAAGTGCAGTCTCA Chr3:16104708..16104727 60.02 55
upstream ENSMUSE00000676367 Chr3:16103826..16105424 CCTCACCAAGTGCAGTCTCA Chr3:16104708..16104727 60.02 55
upstream ENSMUSE00000676364 Chr3:16105529..16105542 No primer for this exon

*** Putative Vector Insertion (Chr 3: 16105543 - 16113954) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676366 Chr3:16113955..16116852 CACACGGTGGTTATTGCTTG Chr3:16113991..16114010 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGGAGGTAATCGCCTTG Chr3:16111585..16111605 60.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCGTGACTGGGAAAACC Chr3:16111590..16111610 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047213