Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16325
Trapped Gene
BC017647 (ENSMUSG00000037750)
Vector Insertion
Chr 11: 77929340 - 77956594
Public Clones (sanger) IST10906F2 (tigm) IST10070H6 (tigm)
Private Clones OST463135 (lexicon) OST430031 (lexicon) OST390314 (lexicon) OST389083 (lexicon)
OST370915 (lexicon) OST348464 (lexicon) OST317815 (lexicon) OST309673 (lexicon)
OST294855 (lexicon) OST278543 (lexicon) OST277247 (lexicon) OST265315 (lexicon)
OST240563 (lexicon) OST230815 (lexicon) OST209232 (lexicon) OST172876 (lexicon)
OST147354 (lexicon) OST146490 (lexicon) OST145056 (lexicon) OST139818 (lexicon)
OST135200 (lexicon) OST98153 (lexicon) OST90075 (lexicon) OST81461 (lexicon)
OST68306 (lexicon) OST59025 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000650166 (Chr11:77929128..77929339 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGAGCCAACATCACCTCCT Chr11:77929306..77929325 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000650166 (Chr11:77929128..77929339 +)
Downstram Exon
ENSMUSE00000289966 (Chr11:77956595..77956716 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGAGCCAACATCACCTCCT Chr11:77929306..77929325 60.26 55 GACCAGCATCAGCACAACAT Chr11:77956633..77956652 59.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650170 Chr11:77908214..77908293 No primer for this exon
upstream ENSMUSE00000650166 Chr11:77929128..77929339 CAGAGCCAACATCACCTCCT Chr11:77929306..77929325 60.26 55

*** Putative Vector Insertion (Chr 11: 77929340 - 77956594) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000289966 Chr11:77956595..77956716 GACCAGCATCAGCACAACAT Chr11:77956633..77956652 59.71 50
downstream ENSMUSE00000498263 Chr11:77967199..77970839 TTGGGGGACATACGGAATTA Chr11:77969221..77969240 60.01 45
downstream ENSMUSE00000650165 Chr11:77967199..77969549 TTGGGGGACATACGGAATTA Chr11:77969221..77969240 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTTTGCTAATCGCCTTGC Chr11:77947383..77947403 61.86 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGGGGATATCAGGTAGACAA Chr11:77947353..77947375 59.31 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037750