Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16326
Trapped Gene
Tomm7 (ENSMUSG00000028998)
Vector Insertion
Chr 5: 23345647 - 23347527
Public Clones not available
Private Clones OST463130 (lexicon) OST463123 (lexicon) OST446990 (lexicon) OST430911 (lexicon)
OST427920 (lexicon) OST424956 (lexicon) OST418812 (lexicon) OST305505 (lexicon)
OST299757 (lexicon) OST273940 (lexicon) OST270082 (lexicon) OST270077 (lexicon)
OST174857 (lexicon) OST153697 (lexicon) OST84737 (lexicon) OST59806 (lexicon)
OST59803 (lexicon) OST58396 (lexicon) OST44134 (lexicon) OST43140 (lexicon)
OST43056 (lexicon) OST43049 (lexicon) OST41375 (lexicon) OST18000 (lexicon)
OST8585 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000184329 (Chr5:23347528..23347576 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTACAAGGGGTGCAGATCCT Chr5:23347554..23347573 59.55 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000184329 (Chr5:23347528..23347576 -)
Downstram Exon
ENSMUSE00000602608 (Chr5:23345472..23345646 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTACAAGGGGTGCAGATCCT Chr5:23347554..23347573 59.55 50 CTCTGCCACAGAATCGTTGA Chr5:23345507..23345526 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000184331 Chr5:23349789..23349925 GCTGGGGCTTTATTCCTCTC Chr5:23349802..23349821 60.17 55
upstream ENSMUSE00000184329 Chr5:23347528..23347576 TTACAAGGGGTGCAGATCCT Chr5:23347554..23347573 59.55 50

*** Putative Vector Insertion (Chr 5: 23345647 - 23347527) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000602608 Chr5:23345472..23345646 CTCTGCCACAGAATCGTTGA Chr5:23345507..23345526 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTACAAGGGGTGCAGATCCT Chr5:23347552..23347572 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACAAGGGGTGCAGATCCT Chr5:23347552..23347572 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028998