Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16327
Trapped Gene
Rnf17 (ENSMUSG00000000365)
Vector Insertion
Chr 14: 57099647 - 57100803
Public Clones not available
Private Clones OST463112 (lexicon)
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648428 (Chr14:57099529..57099646 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648428 (Chr14:57099529..57099646 +)
Downstram Exon
ENSMUSE00000648427 (Chr14:57100804..57101031 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000615496 Chr14:57021534..57021661 No primer for this exon
upstream ENSMUSE00000615495 Chr14:57024414..57024508 No primer for this exon
upstream ENSMUSE00000615494 Chr14:57039912..57040003 No primer for this exon
upstream ENSMUSE00000615493 Chr14:57043295..57043406 No primer for this exon
upstream ENSMUSE00000615492 Chr14:57044437..57044508 No primer for this exon
upstream ENSMUSE00000615491 Chr14:57046725..57046825 No primer for this exon
upstream ENSMUSE00000615490 Chr14:57050315..57050486 No primer for this exon
upstream ENSMUSE00000615489 Chr14:57053158..57053234 No primer for this exon
upstream ENSMUSE00000615488 Chr14:57053434..57053508 No primer for this exon
upstream ENSMUSE00000124801 Chr14:57057441..57057745 No primer for this exon
upstream ENSMUSE00000310667 Chr14:57060368..57060457 No primer for this exon
upstream ENSMUSE00000310660 Chr14:57078803..57078961 No primer for this exon
upstream ENSMUSE00000310652 Chr14:57080718..57080907 No primer for this exon
upstream ENSMUSE00000615517 Chr14:57081861..57082029 No primer for this exon
upstream ENSMUSE00000648434 Chr14:57084464..57084654 No primer for this exon
upstream ENSMUSE00000648433 Chr14:57086502..57086643 No primer for this exon
upstream ENSMUSE00000648432 Chr14:57090128..57090281 No primer for this exon
upstream ENSMUSE00000648430 Chr14:57094235..57094350 No primer for this exon
upstream ENSMUSE00000648429 Chr14:57096426..57096543 No primer for this exon
upstream ENSMUSE00000648428 Chr14:57099529..57099646 No primer for this exon

*** Putative Vector Insertion (Chr 14: 57099647 - 57100803) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648427 Chr14:57100804..57101031 No primer for this exon
downstream ENSMUSE00000648426 Chr14:57101911..57102061 No primer for this exon
downstream ENSMUSE00000648425 Chr14:57102201..57102319 No primer for this exon
downstream ENSMUSE00000648422 Chr14:57103991..57104081 No primer for this exon
downstream ENSMUSE00000648421 Chr14:57105799..57105914 No primer for this exon
downstream ENSMUSE00000615484 Chr14:57111955..57112241 No primer for this exon
downstream ENSMUSE00000615483 Chr14:57119265..57119428 No primer for this exon
downstream ENSMUSE00000615482 Chr14:57122755..57122874 No primer for this exon
downstream ENSMUSE00000615481 Chr14:57124764..57124844 No primer for this exon
downstream ENSMUSE00000615480 Chr14:57126655..57126780 No primer for this exon
downstream ENSMUSE00000615479 Chr14:57128116..57128172 No primer for this exon
downstream ENSMUSE00000615478 Chr14:57131048..57131164 No primer for this exon
downstream ENSMUSE00000615477 Chr14:57132873..57133041 No primer for this exon
downstream ENSMUSE00000615476 Chr14:57135173..57135308 No primer for this exon
downstream ENSMUSE00000615475 Chr14:57141211..57141400 No primer for this exon
downstream ENSMUSE00000615474 Chr14:57143143..57143242 No primer for this exon
downstream ENSMUSE00000615497 Chr14:57143650..57143869 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr14:57099695..57099715 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTTATCAAAGCGTGACTGG Chr14:57099687..57099707 59.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000365