Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16349
Trapped Gene
Rbm14 (ENSMUSG00000006456)
Vector Insertion
Chr 19: 4804016 - 4811171
Public Clones (sanger) (sanger) (sanger) E036B01 (ggtc) (ggtc) (cmhd)
CMHD-GT_540F9-5S (cmhd) IST15072G4 (tigm) IST14583A2 (tigm) IST12523B2 (tigm)
IST14504G2 (tigm) IST13633C7 (tigm) IST14820A12 (tigm)
Private Clones OST462831 (lexicon) OST197615 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644400 (Chr19:4811172..4811337 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644400 (Chr19:4811172..4811337 -)
Downstram Exon
ENSMUSE00000383243 (Chr19:4802814..4804015 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644402 Chr19:4811368..4811508 No primer for this exon
upstream ENSMUSE00000644401 Chr19:4811339..4811365 No primer for this exon
upstream ENSMUSE00000491909 Chr19:4811172..4811603 No primer for this exon
upstream ENSMUSE00000644400 Chr19:4811172..4811337 No primer for this exon

*** Putative Vector Insertion (Chr 19: 4804016 - 4811171) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383243 Chr19:4802814..4804015 No primer for this exon
downstream ENSMUSE00000332945 Chr19:4802723..4802812 No primer for this exon
downstream ENSMUSE00000332938 Chr19:4802670..4802720 No primer for this exon
downstream ENSMUSE00000499553 Chr19:4802623..4802667 No primer for this exon
downstream ENSMUSE00000644403 Chr19:4802551..4804015 No primer for this exon
downstream ENSMUSE00000696979 Chr19:4802523..4804015 No primer for this exon
downstream ENSMUSE00000696977 Chr19:4802495..4802518 No primer for this exon
downstream ENSMUSE00000444479 Chr19:4800925..4801805 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCTTTCCAGTCTCCCTTCC Chr19:4805192..4805213 60.06 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCTTTCCAGTCTCCCTTCC Chr19:4805192..4805213 60.06 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGAACCTTAGTCCATCCGGTA Chr19:4808285..4808306 60.19 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGTATTTGTTTGGAGGCGTTT Chr19:4805340..4805361 60.23 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006456