Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16352
Trapped Gene
Mt2 (ENSMUSG00000031762)
Vector Insertion
Chr 8: 96697093 - 96697235
Public Clones CMHD-GT_363A3-3 (cmhd)
Private Clones OST462591 (lexicon) OST190723 (lexicon)
Severity of mutation (?) Insertion after 52% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212752 (Chr8:96697027..96697092 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAATGCAAACAATGCAAATG Chr8:96697055..96697075 59.99 33.33 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212752 (Chr8:96697027..96697092 +)
Downstram Exon
ENSMUSE00000212749 (Chr8:96697236..96697462 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAATGCAAACAATGCAAATG Chr8:96697055..96697075 59.99 33.33 CACTTGTCGGAAGCCTCTTT Chr8:96697314..96697333 59.47 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000331875 Chr8:96696684..96696775 CCGATCTCTCGTCGATCTTC Chr8:96696708..96696727 59.91 55
upstream ENSMUSE00000212752 Chr8:96697027..96697092 CAAATGCAAACAATGCAAATG Chr8:96697055..96697075 59.99 33.33

*** Putative Vector Insertion (Chr 8: 96697093 - 96697235) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212749 Chr8:96697236..96697462 CACTTGTCGGAAGCCTCTTT Chr8:96697314..96697333 59.47 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCTATAATCGCCTTGCAG Chr8:96697138..96697158 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCCTACGTGACTGGGAAA Chr8:96697137..96697157 59.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031762