Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16356
Trapped Gene
A230083H22Rik (ENSMUSG00000039126)
Vector Insertion
Chr 19: 17242833 - 17253279
Public Clones (sanger) E129G11 (ggtc) E036C07 (ggtc)
Private Clones OST462456 (lexicon) OST456548 (lexicon) OST456547 (lexicon) OST430032 (lexicon)
OST424136 (lexicon) OST413225 (lexicon) OST277515 (lexicon) OST240445 (lexicon)
OST232766 (lexicon) OST226933 (lexicon) OST217946 (lexicon) OST184405 (lexicon)
OST172528 (lexicon) OST128864 (lexicon) OST127407 (lexicon) OST124309 (lexicon)
OST119082 (lexicon) OST118538 (lexicon) OST76512 (lexicon) OST73844 (lexicon)
OST66089 (lexicon) OST64420 (lexicon) OST63748 (lexicon) OST58280 (lexicon)
OST55830 (lexicon) OST44609 (lexicon) OST38752 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000620828 (Chr19:17242753..17242832 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCACTTCGAGGAGGGAGT Chr19:17242781..17242800 60.07 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000620828 (Chr19:17242753..17242832 +)
Downstram Exon
ENSMUSE00000230568 (Chr19:17253280..17253480 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCACTTCGAGGAGGGAGT Chr19:17242781..17242800 60.07 55 TGACTGCCATTGAGATCCAG Chr19:17253316..17253335 59.79 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490413 Chr19:17197459..17199082 CAGCGAACCCCAACATAACT Chr19:17197692..17197711 59.99 50
upstream ENSMUSE00000620829 Chr19:17199428..17200193 AAAACCCTGCACAAGACCAG Chr19:17199791..17199810 60.15 50
upstream ENSMUSE00000642599 Chr19:17211254..17211381 TCACGTGACCAGAAAATGGA Chr19:17211254..17211273 60.09 45
upstream ENSMUSE00000620828 Chr19:17242753..17242832 ATCCACTTCGAGGAGGGAGT Chr19:17242781..17242800 60.07 55
upstream ENSMUSE00000642598 Chr19:17242753..17242832 ATCCACTTCGAGGAGGGAGT Chr19:17242781..17242800 60.07 55

*** Putative Vector Insertion (Chr 19: 17242833 - 17253279) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000230568 Chr19:17253280..17253480 TGACTGCCATTGAGATCCAG Chr19:17253316..17253335 59.79 50
downstream ENSMUSE00000230548 Chr19:17267746..17267919 TTCATGTCAATCCGTTGCTC Chr19:17267884..17267903 59.65 45
downstream ENSMUSE00000693441 Chr19:17270413..17270421 No primer for this exon
downstream ENSMUSE00000230524 Chr19:17273603..17273705 CATTCAGACCGTCCCCATAG Chr19:17273629..17273648 60.33 55
downstream ENSMUSE00000230419 Chr19:17274271..17274402 TTGGGGTTGCACCATTTAAG Chr19:17274347..17274366 60.72 45
downstream ENSMUSE00000230392 Chr19:17276132..17276218 AAAGGCCGAGTCACTGCTAA Chr19:17276215..17276234 60.01 50
downstream ENSMUSE00000400538 Chr19:17282721..17282819 GCTCTCTGGAATGTGGATGC Chr19:17282814..17282833 60.78 55
downstream ENSMUSE00000620827 Chr19:17286168..17286203 No primer for this exon
downstream ENSMUSE00000360440 Chr19:17286782..17286820 ATGCCTCCCTCAGTTCTTCA Chr19:17286810..17286829 59.8 50
downstream ENSMUSE00000346771 Chr19:17290816..17290863 No primer for this exon
downstream ENSMUSE00000409716 Chr19:17295274..17296299 GGTAGGTACGTCCCAGCAAA Chr19:17295366..17295385 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr19:17248884..17248904 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTAAGCCTGCCTTCTTCA Chr19:17248845..17248865 58.65 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039126