Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16360
Trapped Gene
Sertad3 (ENSMUSG00000055200)
Vector Insertion
Chr 7: 28258891 - 28261158
Public Clones IST14963F1 (tigm)
Private Clones OST462383 (lexicon) OST425541 (lexicon) OST412886 (lexicon) OST319668 (lexicon)
OST250946 (lexicon) OST250913 (lexicon) OST250858 (lexicon) OST215253 (lexicon)
OST124218 (lexicon) OST105179 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636185 (Chr7:28258787..28258890 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGCTTGTCGGAGGTAGTC Chr7:28258850..28258869 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636185 (Chr7:28258787..28258890 +)
Downstram Exon
ENSMUSE00000419065 (Chr7:28261159..28262378 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGCTTGTCGGAGGTAGTC Chr7:28258850..28258869 59.87 60 TTTCCACCGCAGATGTATCA Chr7:28261648..28261667 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636185 Chr7:28258787..28258890 CAGGCTTGTCGGAGGTAGTC Chr7:28258850..28258869 59.87 60

*** Putative Vector Insertion (Chr 7: 28258891 - 28261158) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000419065 Chr7:28261159..28262378 TTTCCACCGCAGATGTATCA Chr7:28261648..28261667 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCCTGGAGTTAGAGGAGGA Chr7:28258919..28258939 58.81 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCCTGGAGTTAGAGGAGGA Chr7:28258919..28258939 58.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055200