Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16368
Trapped Gene
Rgma (ENSMUSG00000070509)
Vector Insertion
Chr 7: 80536266 - 80536383
Public Clones not available
Private Clones OST462253 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000712168 (Chr7:80536155..80536382 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGATGGGTATGGGGAGAG Chr7:80536297..80536316 60.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000712168 (Chr7:80536155..80536382 +)
Downstram Exon
ENSMUSE00000634198 (Chr7:80536267..80536382 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGATGGGTATGGGGAGAG Chr7:80536297..80536316 60.93 55 AGCTCGGCCTGTTACCACTA Chr7:80536297..80536316 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708790 Chr7:80520406..80520774 CGCCCTACACCTAGTCTTCG Chr7:80520696..80520715 59.89 60
upstream ENSMUSE00000673181 Chr7:80520761..80520774 No primer for this exon
upstream ENSMUSE00000712168 Chr7:80536155..80536382 ATGGATGGGTATGGGGAGAG Chr7:80536297..80536316 60.93 55
upstream ENSMUSE00000722164 Chr7:80536155..80536382 ATGGATGGGTATGGGGAGAG Chr7:80536297..80536316 60.93 55

*** Putative Vector Insertion (Chr 7: 80536266 - 80536383) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634198 Chr7:80536267..80536382 AGCTCGGCCTGTTACCACTA Chr7:80536297..80536316 59.9 55
downstream ENSMUSE00000592614 Chr7:80554118..80554635 AGGCCGCAGTGAGTGTAGTT Chr7:80554487..80554506 59.94 55
downstream ENSMUSE00000592620 Chr7:80554118..80554635 AGGCCGCAGTGAGTGTAGTT Chr7:80554487..80554506 59.94 55
downstream ENSMUSE00000708021 Chr7:80554118..80554635 AGGCCGCAGTGAGTGTAGTT Chr7:80554487..80554506 59.94 55
downstream ENSMUSE00000592613 Chr7:80562203..80563228 AGTCGTGAGGAGGTCGAAGA Chr7:80562709..80562728 59.99 55
downstream ENSMUSE00000712124 Chr7:80562203..80564785 AGTCGTGAGGAGGTCGAAGA Chr7:80562709..80562728 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGATGGGTATGGGGAGATA Chr7:80536299..80536319 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTATGGGGAGACGTGACTGG Chr7:80536306..80536326 60.39 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070509