Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16396
Trapped Gene
Sppl3 (ENSMUSG00000029550)
Vector Insertion
Chr 5: 115511571 - 115511649
Public Clones not available
Private Clones OST461759 (lexicon) OST461186 (lexicon) OST436070 (lexicon) OST432141 (lexicon)
OST430317 (lexicon) OST416979 (lexicon) OST413829 (lexicon) OST401041 (lexicon)
OST384662 (lexicon) OST382302 (lexicon) OST374718 (lexicon) OST345794 (lexicon)
OST267726 (lexicon) OST160543 (lexicon) OST147828 (lexicon) OST135801 (lexicon)
OST114054 (lexicon) OST113258 (lexicon) OST97544 (lexicon) OST66914 (lexicon)
OST60923 (lexicon) OST56680 (lexicon) OST48953 (lexicon) OST43557 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189991 (Chr5:115511571..115511648 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGACTCCAGTCAAGTGTCG Chr5:115511585..115511604 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189991 (Chr5:115511571..115511648 +)
Downstram Exon
ENSMUSE00000690572 (Chr5:115511572..115511648 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGACTCCAGTCAAGTGTCG Chr5:115511585..115511604 59.86 55 CTGGAGTCCACCAGGGAATA Chr5:115511597..115511616 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000594791 Chr5:115461533..115461624 GGCGGAACAGACCTATTCGT Chr5:115461604..115461623 61.4 55
upstream ENSMUSE00000690573 Chr5:115511188..115511211 No primer for this exon
upstream ENSMUSE00000189991 Chr5:115511571..115511648 TGGACTCCAGTCAAGTGTCG Chr5:115511585..115511604 59.86 55

*** Putative Vector Insertion (Chr 5: 115511571 - 115511649) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000690572 Chr5:115511572..115511648 CTGGAGTCCACCAGGGAATA Chr5:115511597..115511616 59.92 55
downstream ENSMUSE00000268808 Chr5:115524824..115524912 TATTGGTGCTGTTGCCATTG Chr5:115524912..115524931 60.52 45
downstream ENSMUSE00000189982 Chr5:115532230..115532349 TTGGGTGGAATCAATGGTCT Chr5:115532258..115532277 60.17 45
downstream ENSMUSE00000189999 Chr5:115533434..115533512 GCACATCGGGAGAAGAAGAA Chr5:115533480..115533499 60.34 50
downstream ENSMUSE00000189994 Chr5:115534862..115534974 TGAGGACGAGCATGACAGAC Chr5:115534941..115534960 59.99 55
downstream ENSMUSE00000189980 Chr5:115538299..115538405 GAGAAGCCCTGAGAGAAGCA Chr5:115538390..115538409 59.83 55
downstream ENSMUSE00000189985 Chr5:115538832..115538995 AGACAGGCGAGGAACATCAC Chr5:115538972..115538991 60.27 55
downstream ENSMUSE00000189997 Chr5:115545060..115545259 GGGTGCAGTGGAAGTAGGAG Chr5:115545244..115545263 59.72 60
downstream ENSMUSE00000189988 Chr5:115545855..115545964 TTAGGTAGGCCATGGTGAGG Chr5:115545965..115545984 59.95 55
downstream ENSMUSE00000348997 Chr5:115547135..115548799 CCAAGTGTGAGGTGATGGTG Chr5:115548573..115548592 60 55
downstream ENSMUSE00000690571 Chr5:115547135..115548262 CTATCAGTTCAGCGCATCCA Chr5:115548056..115548075 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAGGGCCTATTCCCTGGTG Chr5:115511568..115511588 60.83 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGGGCCTATTCCCTGGTG Chr5:115511568..115511588 60.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029550