Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16402
Trapped Gene
Cebpz (ENSMUSG00000024081)
Vector Insertion
Chr 17: 79335408 - 79336214
Public Clones not available
Private Clones OST461680 (lexicon) OST444504 (lexicon) OST57128 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138189 (Chr17:79336215..79336390 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGAAGATCCGGATGAGGAA Chr17:79336287..79336306 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138189 (Chr17:79336215..79336390 -)
Downstram Exon
ENSMUSE00000256126 (Chr17:79333915..79335407 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGAAGATCCGGATGAGGAA Chr17:79336287..79336306 60.15 50 GTGTCCCTGATGACACGATG Chr17:79334812..79334831 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000138189 Chr17:79336215..79336390 CAGAAGATCCGGATGAGGAA Chr17:79336287..79336306 60.15 50

*** Putative Vector Insertion (Chr 17: 79335408 - 79336214) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000256126 Chr17:79333915..79335407 GTGTCCCTGATGACACGATG Chr17:79334812..79334831 59.96 55
downstream ENSMUSE00000138179 Chr17:79331450..79331681 TGAGAAACATCGCTTGCTTG Chr17:79331607..79331626 60.13 45
downstream ENSMUSE00000138195 Chr17:79330650..79330836 ATCTCCCACGTCAACGAAGT Chr17:79330779..79330798 59.58 50
downstream ENSMUSE00000138208 Chr17:79328618..79328706 TCAGCTCCGCAGAATAAAGG Chr17:79328624..79328643 60.48 50
downstream ENSMUSE00000138181 Chr17:79326209..79326262 AAAAAGGGCCACAGAAGGAT Chr17:79326205..79326224 59.94 45
downstream ENSMUSE00000138211 Chr17:79325423..79325525 TGGGTCCCCTGAGTATTGAA Chr17:79325474..79325493 60.31 50
downstream ENSMUSE00000138173 Chr17:79325254..79325322 TTGGGTTGCATCACAACACT Chr17:79325270..79325289 60.01 45
downstream ENSMUSE00000138170 Chr17:79323786..79323852 CTTCATCCACTGGGATCTGG Chr17:79323777..79323796 60.47 55
downstream ENSMUSE00000138186 Chr17:79322576..79322676 CATCTGCACTGCGTTTCTGT Chr17:79322602..79322621 60.06 50
downstream ENSMUSE00000255944 Chr17:79321854..79321911 GGGAAGCAGTTGTCGTCTTC Chr17:79321862..79321881 59.85 55
downstream ENSMUSE00000138192 Chr17:79321470..79321654 CCATGAACGTTCCTCCATCT Chr17:79321481..79321500 59.93 50
downstream ENSMUSE00000138215 Chr17:79320975..79321061 AGTATTGGCTTTGGGGTTGG Chr17:79321008..79321027 61.09 50
downstream ENSMUSE00000138176 Chr17:79320062..79320120 CAAACAGGCTGGAGTCATTG Chr17:79320054..79320073 59.29 50
downstream ENSMUSE00000138202 Chr17:79319889..79319970 TGGCGTTCATGCCAATAGTA Chr17:79319888..79319907 60.1 45
downstream ENSMUSE00000138166 Chr17:79319093..79319357 AGTCATCTCGCTCAGCTTCC Chr17:79319297..79319316 59.71 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:79336144..79336164 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCCTGGAGGAGGTGTTAC Chr17:79336230..79336250 58.59 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024081