Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16409
Trapped Gene
Stk38 (ENSMUSG00000024006)
Vector Insertion
Chr 17: 29136953 - 29137087
Public Clones not available
Private Clones OST461630 (lexicon) OST453487 (lexicon) OST443649 (lexicon) OST415703 (lexicon)
OST199793 (lexicon) OST185574 (lexicon) OST150854 (lexicon) OST129007 (lexicon)
OST59697 (lexicon) OST38362 (lexicon) OST37513 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711234 (Chr17:29136954..29137086 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711234 (Chr17:29136954..29137086 -)
Downstram Exon
ENSMUSE00000238312 (Chr17:29136954..29137086 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50 TGAGCAAGGTGTTGATCCTG Chr17:29137033..29137052 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000431121 Chr17:29144656..29144882 GCAGTTGGGGTTCTTCCTTT Chr17:29144795..29144814 60.48 50
upstream ENSMUSE00000238312 Chr17:29136954..29137086 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000710202 Chr17:29136954..29137089 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50
upstream ENSMUSE00000711234 Chr17:29136954..29137086 CAGGATCAACACCTTGCTCA Chr17:29137055..29137074 59.83 50

*** Putative Vector Insertion (Chr 17: 29136953 - 29137087) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000238301 Chr17:29129362..29129413 TCTTCGTCTTTCAGGCCTTC Chr17:29129341..29129360 59.55 50
downstream ENSMUSE00000137178 Chr17:29128243..29128365 GCGGATCTTCTGAGTCGTTT Chr17:29128324..29128343 59.43 50
downstream ENSMUSE00000137194 Chr17:29125123..29125206 CTTTGCGCAGGATTTTCATT Chr17:29125124..29125143 60.21 40
downstream ENSMUSE00000137186 Chr17:29121022..29121145 CACAAACTGTCTGCCTCCAC Chr17:29121071..29121090 59.31 55
downstream ENSMUSE00000137185 Chr17:29118977..29119131 TGCTGTCCAAGAGAAGGTTG Chr17:29118957..29118976 59.01 50
downstream ENSMUSE00000549113 Chr17:29117330..29117467 CCTCATGGCACAGCAAGTAA Chr17:29117383..29117402 59.86 50
downstream ENSMUSE00000137179 Chr17:29116148..29116250 AAAGGCCAAAGTCGGAAAGT Chr17:29116198..29116217 60.11 45
downstream ENSMUSE00000137183 Chr17:29114485..29114546 GCTGGCGTCTGTTTCTTTTC Chr17:29114465..29114484 60 50
downstream ENSMUSE00000137192 Chr17:29112764..29112881 TGTAACCCGTCTGCATGAAC Chr17:29112796..29112815 59.57 50
downstream ENSMUSE00000137180 Chr17:29111491..29111614 ATGTCTCTTGTGGGGTCTCG Chr17:29111554..29111573 60.11 55
downstream ENSMUSE00000238116 Chr17:29111227..29111322 AGGGGCTCCGATTCTATGTT Chr17:29111264..29111283 59.92 50
downstream ENSMUSE00000137176 Chr17:29109990..29110084 No primer for this exon
downstream ENSMUSE00000717891 Chr17:29109182..29109621 AGGCCCTATTTTGCTGCTTT Chr17:29109464..29109483 60.22 45
downstream ENSMUSE00000408447 Chr17:29107830..29109621 TAGGCAGTGTGTGCCTCAAG Chr17:29108677..29108696 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGGCAATGACAGGATCAA Chr17:29137064..29137084 60.48 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGGCAATGACAGGATCAA Chr17:29137064..29137084 60.48 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024006