Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16411
Trapped Gene
Tnfrsf21 (ENSMUSG00000023915)
Vector Insertion
Chr 17: 43202183 - 43222284
Public Clones IST10926C4 (tigm) IST10926C4 (tigm) IST14953D12 (tigm)
Private Clones OST461613 (lexicon) OST436890 (lexicon) OST186854 (lexicon) OST30308 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000490105 (Chr17:43201917..43202182 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGCAATGATGTTGTGGAG Chr17:43202130..43202149 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000490105 (Chr17:43201917..43202182 +)
Downstram Exon
ENSMUSE00000136326 (Chr17:43222285..43222513 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGCAATGATGTTGTGGAG Chr17:43202130..43202149 60.12 50 TCTGACTCGTCCACGAAGAA Chr17:43222442..43222461 59.54 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435335 Chr17:43153504..43154041 GCTTGATAGTGGCTGGAAGC Chr17:43153574..43153593 59.99 55
upstream ENSMUSE00000136327 Chr17:43174544..43175195 AACGTACGTCTCCGAGCACT Chr17:43174666..43174685 59.94 55
upstream ENSMUSE00000136325 Chr17:43176644..43177138 TTGGATGATCGTCCTCTTCC Chr17:43176948..43176967 60.01 50
upstream ENSMUSE00000490105 Chr17:43201917..43202182 GACGCAATGATGTTGTGGAG Chr17:43202130..43202149 60.12 50

*** Putative Vector Insertion (Chr 17: 43202183 - 43222284) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136326 Chr17:43222285..43222513 TCTGACTCGTCCACGAAGAA Chr17:43222442..43222461 59.54 50
downstream ENSMUSE00000402555 Chr17:43224692..43226137 AACTCACCGGCCATACACTC Chr17:43225042..43225061 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGGTTCTTACCAGCTTTGG Chr17:43217213..43217234 61.15 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGGTTCTTACCAGCTTTGG Chr17:43217213..43217234 61.15 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023915