Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1642
Trapped Gene
Ctcf (ENSMUSG00000005698)
Vector Insertion
Chr 8: 108160621 - 108167415
Public Clones DD0129 (sanger) P138D04 (ggtc) P107D12 (ggtc) (ggtc) P149E03 (ggtc)
D075B10 (ggtc) P116F05 (ggtc) (ggtc) D076F01 (ggtc) (ggtc)
P138D04 (ggtc) D023C08 (ggtc) 5SP126F09 (ggtc) P107D12 (ggtc) (ggtc)
D075B10 (ggtc) FHCRC-GT-S1-5D1 (fhcrc) PST24667-NR (escells) IST14969G6 (tigm)
IST11613C6 (tigm) IST14232G7 (tigm) IST14583D12 (tigm) IST14572E10 (tigm)
IST13878D4 (tigm) IST13248A6 (tigm)
Private Clones OST446309 (lexicon) OST446050 (lexicon) OST375246 (lexicon) OST330024 (lexicon)
OST328178 (lexicon) OST327819 (lexicon) OST323815 (lexicon) OST323726 (lexicon)
OST316244 (lexicon) OST297310 (lexicon) OST293175 (lexicon) OST279795 (lexicon)
OST279200 (lexicon) OST259229 (lexicon) OST244685 (lexicon) OST232547 (lexicon)
OST216120 (lexicon) OST212212 (lexicon) OST205193 (lexicon) OST166160 (lexicon)
OST147627 (lexicon) OST147626 (lexicon) OST141461 (lexicon) OST135380 (lexicon)
OST126050 (lexicon) OST123065 (lexicon) OST119063 (lexicon) OST115680 (lexicon)
OST115001 (lexicon) OST92151 (lexicon) OST86095 (lexicon) OST67812 (lexicon)
OST67332 (lexicon) OST65058 (lexicon) OST61839 (lexicon) OST59181 (lexicon)
OST45458 (lexicon) OST45346 (lexicon) OST41742 (lexicon) OST40310 (lexicon)
OST36726 (lexicon) OST35245 (lexicon) OST30371 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000229428 (Chr8:108160479..108160620 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000229428 (Chr8:108160479..108160620 +)
Downstram Exon
ENSMUSE00000229392 (Chr8:108167416..108167532 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000229428 Chr8:108160479..108160620 No primer for this exon

*** Putative Vector Insertion (Chr 8: 108160621 - 108167415) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000229392 Chr8:108167416..108167532 No primer for this exon
downstream ENSMUSE00000229368 Chr8:108187654..108188443 No primer for this exon
downstream ENSMUSE00000214403 Chr8:108188756..108188926 No primer for this exon
downstream ENSMUSE00000214402 Chr8:108190559..108190692 No primer for this exon
downstream ENSMUSE00000214398 Chr8:108194131..108194251 No primer for this exon
downstream ENSMUSE00000214401 Chr8:108195191..108195340 No primer for this exon
downstream ENSMUSE00000439139 Chr8:108198769..108198929 No primer for this exon
downstream ENSMUSE00000229273 Chr8:108199896..108200078 No primer for this exon
downstream ENSMUSE00000229249 Chr8:108201115..108201250 No primer for this exon
downstream ENSMUSE00000229217 Chr8:108203971..108204159 No primer for this exon
downstream ENSMUSE00000358422 Chr8:108205335..108206821 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTAATCGCCTTGCAGCAC Chr8:108166669..108166689 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAAGATAACCCAAAGGGACT Chr8:108166611..108166632 59.47 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005698