Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16434
Trapped Gene
Hmgn1 (ENSMUSG00000040681)
Vector Insertion
Chr 16: 96346453 - 96348759
Public Clones E139H12 (ggtc) PST26369-NR (escells) PST21626-NR (escells) PST17933-NL (escells)
PST25815-NR (escells) PST21047-NL (escells) PST23138-NR (escells) PST19585-NR (escells)
Private Clones OST461397 (lexicon) OST360551 (lexicon) OST336654 (lexicon) OST55809 (lexicon)
OST38587 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000389240 (Chr16:96348760..96348810 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000389240 (Chr16:96348760..96348810 -)
Downstram Exon
ENSMUSE00000262291 (Chr16:96346330..96346452 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGGTTTTCCGTCTCTCCATT Chr16:96346309..96346328 59.53 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486012 Chr16:96349197..96349290 No primer for this exon
upstream ENSMUSE00000401384 Chr16:96349039..96349068 No primer for this exon
upstream ENSMUSE00000348811 Chr16:96348918..96348947 No primer for this exon
upstream ENSMUSE00000389240 Chr16:96348760..96348810 No primer for this exon

*** Putative Vector Insertion (Chr 16: 96346453 - 96348759) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000262291 Chr16:96346330..96346452 TGGTTTTCCGTCTCTCCATT Chr16:96346309..96346328 59.53 45
downstream ENSMUSE00000335749 Chr16:96343196..96344024 TCAGTCCCACCAATTCACAA Chr16:96343402..96343421 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr16:96348689..96348709 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTTCGAAAAGGTGTCCAG Chr16:96348735..96348755 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GAATAATCGCCTTGCAGCAC Chr16:96348743..96348763 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTCACACCCCCTTCTTTTA Chr16:96348828..96348848 59.02 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040681