Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16437
Trapped Gene
Lsg1 (ENSMUSG00000022538)
Vector Insertion
Chr 16: 30561949 - 30564731
Public Clones (ggtc) PST20084-NR (escells) PST17328-NR (escells) PST24133-NL (escells)
PST21971-NR (escells) PST23477-NR (escells) PST17719-NR (escells)
Private Clones OST461331 (lexicon) OST460887 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000231298 (Chr16:30564732..30564905 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCTGGAAAAGACCCTGTG Chr16:30564861..30564880 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000231298 (Chr16:30564732..30564905 -)
Downstram Exon
ENSMUSE00000702158 (Chr16:30561459..30561948 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCTGGAAAAGACCCTGTG Chr16:30564861..30564880 59.69 55 CCTGGACACCTTTGGTCAGT Chr16:30561893..30561912 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000231390 Chr16:30587524..30587649 CTGTTGATGCGTGGTTATGG Chr16:30587619..30587638 59.99 50
upstream ENSMUSE00000708461 Chr16:30587524..30587678 CTGTTGATGCGTGGTTATGG Chr16:30587619..30587638 59.99 50
upstream ENSMUSE00000231380 Chr16:30585640..30585766 ATGACTGGGGTCGTCTGAAT Chr16:30585719..30585738 59.38 50
upstream ENSMUSE00000128049 Chr16:30582617..30582737 CTGAGGCTAGAACCGGACTG Chr16:30582691..30582710 60.01 60
upstream ENSMUSE00000128039 Chr16:30582142..30582228 GCCAAATTGGGACAGAAAAAC Chr16:30582208..30582228 60.7 42.86
upstream ENSMUSE00000128040 Chr16:30581045..30581131 TGACTCCCTTTGAACGGAAC Chr16:30581086..30581105 60.09 50
upstream ENSMUSE00000128032 Chr16:30574632..30574692 CCCGCTCCTGTTTAGATGTG Chr16:30574640..30574659 60.65 55
upstream ENSMUSE00000231342 Chr16:30573279..30573455 AAGAGATCGATGCTGCCAAG Chr16:30573423..30573442 60.5 50
upstream ENSMUSE00000231331 Chr16:30571251..30571622 AGGAGTCCGCAAGTGACAGT Chr16:30571500..30571519 59.91 55
upstream ENSMUSE00000128043 Chr16:30569415..30569516 TGGGCTACCCTAATGTTGGT Chr16:30569496..30569515 59.31 50
upstream ENSMUSE00000711017 Chr16:30569200..30569334 CCTCCCTATCGACCAGATGA Chr16:30569217..30569236 60.03 55
upstream ENSMUSE00000128042 Chr16:30569191..30569334 CCTCCCTATCGACCAGATGA Chr16:30569217..30569236 60.03 55
upstream ENSMUSE00000708195 Chr16:30568979..30568982 No primer for this exon
upstream ENSMUSE00000128037 Chr16:30567797..30567920 ATGAAGACCCCTACCGACCT Chr16:30567831..30567850 59.82 55
upstream ENSMUSE00000717779 Chr16:30567797..30567925 ATGAAGACCCCTACCGACCT Chr16:30567831..30567850 59.82 55
upstream ENSMUSE00000231304 Chr16:30565516..30565595 CCTCGATCTGCACGGTACAT Chr16:30565535..30565554 61.09 55
upstream ENSMUSE00000231298 Chr16:30564732..30564905 CTCCTGGAAAAGACCCTGTG Chr16:30564861..30564880 59.69 55

*** Putative Vector Insertion (Chr 16: 30561949 - 30564731) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702158 Chr16:30561459..30561948 CCTGGACACCTTTGGTCAGT Chr16:30561893..30561912 60 55
downstream ENSMUSE00000716429 Chr16:30560580..30561948 CCATTCTCGTTCAACCACCT Chr16:30561077..30561096 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCCAAACAGATCGAAAATGT Chr16:30564755..30564777 60.01 36.36 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCCAAACAGATCGAAAATGT Chr16:30564755..30564777 60.01 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTCCTGGAAAAGACCCTGTG Chr16:30561859..30561879 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTCCTGGAAAAGACCCTGTG Chr16:30561859..30561879 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022538