Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16449
Trapped Gene
Mcph1 (ENSMUSG00000039842)
Vector Insertion
Chr 8: 18788477 - 18801405
Public Clones IST14717G7 (tigm)
Private Clones OST461049 (lexicon)
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000434172 (Chr8:18788239..18788476 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGACTTGAACGCCATTTAT Chr8:18788244..18788263 59.96 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000434172 (Chr8:18788239..18788476 +)
Downstram Exon
ENSMUSE00000332013 (Chr8:18801406..18803186 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGACTTGAACGCCATTTAT Chr8:18788244..18788263 59.96 45 ACTGGGGACACCAACAAGAG Chr8:18802460..18802479 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000374723 Chr8:18595173..18595635 GGCTGTCGTGTGTCACTGAG Chr8:18595413..18595432 60.53 60
upstream ENSMUSE00000367954 Chr8:18596923..18597014 GGACGTTTGCAAAGCAACTT Chr8:18596977..18596996 60.29 45
upstream ENSMUSE00000361861 Chr8:18607279..18607397 GAAGCTGGTTTCCGTCCTCT Chr8:18607368..18607387 60.77 55
upstream ENSMUSE00000408228 Chr8:18622607..18622694 CCTGCAGTGAATACCGATGA Chr8:18622647..18622666 59.67 50
upstream ENSMUSE00000434141 Chr8:18625560..18625674 AAAGGCAAAAGGCAGCTCTA Chr8:18625654..18625673 59.25 45
upstream ENSMUSE00000226129 Chr8:18627118..18627240 ATGACGTTCCTGTCCTCCTG Chr8:18627121..18627140 60.11 55
upstream ENSMUSE00000226124 Chr8:18629546..18629635 ATGTTGGAGCAGTCTCAGCA Chr8:18629554..18629573 59.58 50
upstream ENSMUSE00000226116 Chr8:18631516..18632643 TCCTGACGTTGAGGCTTCTT Chr8:18632030..18632049 59.99 50
upstream ENSMUSE00000226106 Chr8:18641565..18641665 CACAGGCCTTGTCAGACCTC Chr8:18641611..18641630 60.86 60
upstream ENSMUSE00000226097 Chr8:18668946..18668983 ATGACAAGCATGCCATCTGA Chr8:18668964..18668983 60.23 45
upstream ENSMUSE00000226089 Chr8:18671092..18671254 CAGACCCTCATCATCCAGGT Chr8:18671096..18671115 59.92 55
upstream ENSMUSE00000226081 Chr8:18688982..18689059 TAGAGTTGGGCCACTGGATT Chr8:18688995..18689014 59.55 50
upstream ENSMUSE00000434172 Chr8:18788239..18788476 CCGACTTGAACGCCATTTAT Chr8:18788244..18788263 59.96 45

*** Putative Vector Insertion (Chr 8: 18788477 - 18801405) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000332013 Chr8:18801406..18803186 ACTGGGGACACCAACAAGAG Chr8:18802460..18802479 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:18788527..18788547 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTGCGTGACTGGGAAAAC Chr8:18788523..18788543 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039842