Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16455
Trapped Gene
1110037F02Rik (ENSMUSG00000040720)
Vector Insertion
Chr 4: 11476022 - 11476691
Public Clones IST14923H6 (tigm) IST12338C12 (tigm) IST10855F2 (tigm)
Private Clones OST460873 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000177289 (Chr4:11475878..11476021 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAACAAGAGGCTCGAGTTGG Chr4:11475899..11475918 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000177289 (Chr4:11475878..11476021 +)
Downstram Exon
ENSMUSE00000605433 (Chr4:11476692..11478290 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAACAAGAGGCTCGAGTTGG Chr4:11475899..11475918 59.99 55 TGAGGAAACAGCGACATCTG Chr4:11477508..11477527 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000357176 Chr4:11413105..11413252 CGGTGGACTCGTCTATGGAG Chr4:11413194..11413213 60.67 60
upstream ENSMUSE00000721837 Chr4:11413105..11413252 CGGTGGACTCGTCTATGGAG Chr4:11413194..11413213 60.67 60
upstream ENSMUSE00000411884 Chr4:11421911..11422026 GGGAGTACGAGCCCATAGTG Chr4:11421982..11422001 59.57 60
upstream ENSMUSE00000332299 Chr4:11425887..11425973 TAAGCAAACCAAGTGCTCCA Chr4:11425934..11425953 59.46 45
upstream ENSMUSE00000408877 Chr4:11428456..11428504 No primer for this exon
upstream ENSMUSE00000371066 Chr4:11432589..11432757 ACAGCCGACTTTGAAAAGGA Chr4:11432726..11432745 59.85 45
upstream ENSMUSE00000243600 Chr4:11434101..11434223 CGATGAGGACGACCCTATGT Chr4:11434195..11434214 59.95 55
upstream ENSMUSE00000345092 Chr4:11435054..11435326 GAAGAGGAACCGCAAGAAGA Chr4:11435167..11435186 59.55 50
upstream ENSMUSE00000409119 Chr4:11440175..11441315 GCTGGGACCAAGCTAGTGAC Chr4:11440666..11440685 59.87 60
upstream ENSMUSE00000391429 Chr4:11443976..11444125 CACAGCCATCAGCTACTCCA Chr4:11444013..11444032 60.01 55
upstream ENSMUSE00000406656 Chr4:11446073..11446561 CAAGCCACGAAGGATGTTTT Chr4:11446155..11446174 60.11 45
upstream ENSMUSE00000243482 Chr4:11448252..11448406 TTAGAACAGCACGCAGCATC Chr4:11448340..11448359 60.17 50
upstream ENSMUSE00000348692 Chr4:11450000..11450082 GCAAATGGCTTGAACCTCTG Chr4:11450006..11450025 60.78 50
upstream ENSMUSE00000676263 Chr4:11453494..11453587 TGGCCTTACCACTGCCTTAC Chr4:11453526..11453545 60.13 55
upstream ENSMUSE00000386237 Chr4:11453742..11454286 AAGCTCACGATCTCGGAAGA Chr4:11454128..11454147 60.1 50
upstream ENSMUSE00000633428 Chr4:11453742..11454768 TGAAGCGAGTTGGAAGTGTG Chr4:11454423..11454442 60.03 50
upstream ENSMUSE00000243465 Chr4:11454795..11455030 TTGCCTCTCCAACTGCTCTT Chr4:11454964..11454983 60.13 50
upstream ENSMUSE00000243457 Chr4:11455685..11455937 CAGCAGTGCGTGGAGTATGT Chr4:11455887..11455906 59.93 55
upstream ENSMUSE00000243449 Chr4:11457975..11458192 TTGCAGAGCACGATTATGGA Chr4:11458156..11458175 60.37 45
upstream ENSMUSE00000243445 Chr4:11461336..11461468 AGTTTGCTGAAGCGAGTGGT Chr4:11461367..11461386 60.06 50
upstream ENSMUSE00000397336 Chr4:11467057..11467209 CCCGGACGATGAGTCTTAAC Chr4:11467109..11467128 59.55 55
upstream ENSMUSE00000243434 Chr4:11467628..11467788 TGCTGGAGTCATCTGGTGAG Chr4:11467692..11467711 59.98 55
upstream ENSMUSE00000243429 Chr4:11469254..11469350 GTGTTGGCTGATGTCATGGA Chr4:11469264..11469283 60.54 50
upstream ENSMUSE00000349590 Chr4:11471978..11472144 TAGAGCGCTCGTTTCTGTCA Chr4:11472042..11472061 59.89 50
upstream ENSMUSE00000177290 Chr4:11473116..11473447 TCCTCTCGTGGTGGATTTTC Chr4:11473360..11473379 60.05 50
upstream ENSMUSE00000177289 Chr4:11475878..11476021 GAACAAGAGGCTCGAGTTGG Chr4:11475899..11475918 59.99 55

*** Putative Vector Insertion (Chr 4: 11476022 - 11476691) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000605433 Chr4:11476692..11478290 TGAGGAAACAGCGACATCTG Chr4:11477508..11477527 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGCGTTCCTTCTTTTCAGA Chr4:11476025..11476045 59.99 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGCGTTCCTTCTTTTCAGA Chr4:11476025..11476045 59.99 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040720