Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16457
Trapped Gene
Myst4 (ENSMUSG00000021767)
Vector Insertion
Chr 14: 22429085 - 22438112
Public Clones CMHD-GT_510B9-3 (cmhd) CMHD-GT_453B7-3 (cmhd)
Private Clones OST460810 (lexicon) OST433481 (lexicon) OST365101 (lexicon) OST63550 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000120693 (Chr14:22428976..22429084 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGATCCCATTCCAATATGT Chr14:22428983..22429002 59.46 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000120693 (Chr14:22428976..22429084 +)
Downstram Exon
ENSMUSE00000120710 (Chr14:22438113..22438228 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGATCCCATTCCAATATGT Chr14:22428983..22429002 59.46 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377733 Chr14:22319076..22319182 No primer for this exon
upstream ENSMUSE00000650586 Chr14:22320107..22320300 ATGTCGGATTCATGTCAACG Chr14:22320117..22320136 59.37 45
upstream ENSMUSE00000352161 Chr14:22335848..22336720 TGGGTAACGTCTGTGTTGGA Chr14:22336060..22336079 60 50
upstream ENSMUSE00000691743 Chr14:22335848..22339526 TGGGTAACGTCTGTGTTGGA Chr14:22336060..22336079 60 50
upstream ENSMUSE00000691747 Chr14:22336097..22336507 TCTACGCAATGTGGATTGGA Chr14:22336402..22336421 60.07 45
upstream ENSMUSE00000120693 Chr14:22428976..22429084 CCGATCCCATTCCAATATGT Chr14:22428983..22429002 59.46 45

*** Putative Vector Insertion (Chr 14: 22429085 - 22438112) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000120710 Chr14:22438113..22438228 No primer for this exon
downstream ENSMUSE00000120702 Chr14:22438440..22438521 TTGGCATTCTGGAAAGTGGT Chr14:22438521..22438540 60.49 45
downstream ENSMUSE00000120708 Chr14:22441177..22441309 GTTTTGCATATCGCCGTTTT Chr14:22441272..22441291 59.97 40
downstream ENSMUSE00000231429 Chr14:22444055..22444437 TATTTCACCTCGGGATCTGC Chr14:22444361..22444380 60.04 50
downstream ENSMUSE00000231424 Chr14:22445941..22446062 GTCACGAGCTCCTTGTTTCC Chr14:22446016..22446035 59.85 55
downstream ENSMUSE00000231417 Chr14:22448035..22448150 CGAGGAGTACCAGGTTTGGA Chr14:22448130..22448149 60.1 55
downstream ENSMUSE00000120699 Chr14:22450544..22450685 TGAAACCATCCACACTTCTTTG Chr14:22450637..22450658 60.01 40.91
downstream ENSMUSE00000120703 Chr14:22453698..22453859 CCAACCAGATGACAGCCTTT Chr14:22453849..22453868 60.11 50
downstream ENSMUSE00000120701 Chr14:22456769..22456862 TGAGAAAGCGTCCAAATCCT Chr14:22456856..22456875 59.81 45
downstream ENSMUSE00000120698 Chr14:22479965..22480196 TGGTGGCGGTAGAGGTATTC Chr14:22480091..22480110 59.96 55
downstream ENSMUSE00000231392 Chr14:22480650..22480809 TCTCAGCTTCTCGCTCTTCC Chr14:22480807..22480826 59.97 55
downstream ENSMUSE00000231383 Chr14:22481380..22481688 TTGCAGACGATTGCCTACTG Chr14:22481473..22481492 60.01 50
downstream ENSMUSE00000231374 Chr14:22483679..22483970 AGTTGTCGAAGGGCTCATTG Chr14:22483796..22483815 60.26 50
downstream ENSMUSE00000507785 Chr14:22487553..22491354 AGGGGCTTGTATCCACACTG Chr14:22490427..22490446 59.99 55
downstream ENSMUSE00000691746 Chr14:22489967..22490095 TGTGTTCATGTAGCCGTGGT Chr14:22490053..22490072 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGCTTCTTAATCGCCTTGC Chr14:22438128..22438148 59.46 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACATGCTTCTCGTGACTG Chr14:22438124..22438144 60.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021767