Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16464
Trapped Gene
Impa1 (ENSMUSG00000027531)
Vector Insertion
Chr 3: 10328942 - 10329009
Public Clones not available
Private Clones OST460625 (lexicon) OST167814 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717261 (Chr3:10328943..10329008 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717261 (Chr3:10328943..10329008 -)
Downstram Exon
ENSMUSE00000307210 (Chr3:10328943..10329008 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCGCGAGGATTACTGCATAG Chr3:10328935..10328954 59.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000569490 Chr3:10331322..10331388 No primer for this exon
upstream ENSMUSE00000713538 Chr3:10331322..10331439 GACTTCCTGTCGGAGCAATC Chr3:10331402..10331421 59.81 55
upstream ENSMUSE00000307210 Chr3:10328943..10329008 No primer for this exon
upstream ENSMUSE00000717261 Chr3:10328943..10329008 No primer for this exon

*** Putative Vector Insertion (Chr 3: 10328942 - 10329009) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170356 Chr3:10328345..10328478 GTTACCAAGTCGGCTGGAGA Chr3:10328389..10328408 60.26 55
downstream ENSMUSE00000307201 Chr3:10326107..10326211 GTTCCATCAATGGGGTCAAT Chr3:10326103..10326122 59.46 45
downstream ENSMUSE00000569486 Chr3:10324052..10324097 TCACAAGGAAGCCAATTGAA Chr3:10324038..10324057 59.25 40
downstream ENSMUSE00000307193 Chr3:10322904..10323012 TTCCTGCCGGTGTACATCTT Chr3:10322935..10322954 60.52 50
downstream ENSMUSE00000170354 Chr3:10321612..10321720 CCAACTCGGTCACCAAGAGT Chr3:10321666..10321685 60.15 55
downstream ENSMUSE00000170351 Chr3:10316103..10316254 GCAGTGGATTCCCATCTCAT Chr3:10316145..10316164 59.89 50
downstream ENSMUSE00000715414 Chr3:10313954..10316254 TTGTGGGCGCTCTTCTACTT Chr3:10315497..10315516 60.01 50
downstream ENSMUSE00000484413 Chr3:10313949..10315301 TTGCAAAGCAACCTGTCTTG Chr3:10313953..10313972 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr3:10328939..10328959 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGATCTCTGTTGGCTGTG Chr3:10329012..10329032 59.58 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027531