Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16468
Trapped Gene
Brd4 (ENSMUSG00000024002)
Vector Insertion
Chr 17: 32390146 - 32421007
Public Clones (sanger) (sanger) (sanger) P145F08 (ggtc) P121G05 (ggtc) D042H07 (ggtc)
(ggtc) P141G09 (ggtc) P103G10 (ggtc) D014D09 (ggtc) P131H04 (ggtc)
D088B07 (ggtc) P144G12 (ggtc) P120D04 (ggtc) D042H07 (ggtc) (ggtc)
P136C07 (ggtc) P099G11 (ggtc) 3SP141H01 (ggtc) P121G05 (ggtc) D046D03 (ggtc)
(ggtc) P144G12 (ggtc) P103G10 (ggtc) D027F12 (ggtc) P136C07 (ggtc)
D088B07 (ggtc) (cmhd) (cmhd) IST14218C11 (tigm) IST14828D10 (tigm)
IST14424C1 (tigm) IST14612C5 (tigm) IST14865G3 (tigm) IST14516F4 (tigm)
IST13061G9 (tigm) IST14583D6 (tigm)
Private Clones OST460314 (lexicon) OST456001 (lexicon) OST424920 (lexicon) OST367747 (lexicon)
OST346741 (lexicon) OST318204 (lexicon) OST285510 (lexicon) OST283825 (lexicon)
OST281372 (lexicon) OST270969 (lexicon) OST246263 (lexicon) OST224640 (lexicon)
OST195300 (lexicon) OST194245 (lexicon) OST193976 (lexicon) OST193586 (lexicon)
OST142486 (lexicon) OST130448 (lexicon) OST128725 (lexicon) OST110516 (lexicon)
OST108374 (lexicon) OST107992 (lexicon) OST104618 (lexicon) OST101473 (lexicon)
OST67327 (lexicon) OST66712 (lexicon) OST58079 (lexicon) OST45307 (lexicon)
OST43344 (lexicon) OST35685 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709740 (Chr17:32421008..32421042 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709740 (Chr17:32421008..32421042 -)
Downstram Exon
ENSMUSE00000311138 (Chr17:32389986..32390145 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGTTGTGTCCAGACGGAAAG Chr17:32390026..32390045 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381701 Chr17:32421008..32421054 AAGCGACTGCCTCTGGATCT Chr17:32421027..32421046 61.47 55
upstream ENSMUSE00000709740 Chr17:32421008..32421042 No primer for this exon

*** Putative Vector Insertion (Chr 17: 32390146 - 32421007) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000311138 Chr17:32389986..32390145 TGTTGTGTCCAGACGGAAAG Chr17:32390026..32390045 59.72 50
downstream ENSMUSE00000711517 Chr17:32389942..32390145 TGTTGTGTCCAGACGGAAAG Chr17:32390026..32390045 59.72 50
downstream ENSMUSE00000311117 Chr17:32366362..32366680 GGCCTGCGTTGTAGACATTT Chr17:32366532..32366551 60.14 50
downstream ENSMUSE00000714803 Chr17:32366362..32366680 GGCCTGCGTTGTAGACATTT Chr17:32366532..32366551 60.14 50
downstream ENSMUSE00000547604 Chr17:32362521..32362658 TTGTTTTCCAAGCGCTTCTT Chr17:32362572..32362591 60 40
downstream ENSMUSE00000699480 Chr17:32361032..32361167 TTTCTTTCCTCCCTCGTCCT Chr17:32361013..32361032 60.18 50
downstream ENSMUSE00000137065 Chr17:32361029..32361167 TTTCTTTCCTCCCTCGTCCT Chr17:32361013..32361032 60.18 50
downstream ENSMUSE00000137074 Chr17:32358818..32359110 TTGGTACCGTGGATACACCA Chr17:32359056..32359075 59.69 50
downstream ENSMUSE00000137093 Chr17:32358091..32358453 TCCGGTACATCCTTCTTTGG Chr17:32358271..32358290 59.93 50
downstream ENSMUSE00000137069 Chr17:32357106..32357234 ACATCAATCGGACATCAGCA Chr17:32357149..32357168 60.08 45
downstream ENSMUSE00000137090 Chr17:32351576..32351785 TCAGTGGAACTGTCGCTGTC Chr17:32351603..32351622 60.03 55
downstream ENSMUSE00000310929 Chr17:32350472..32350671 CTCACATTGCTGTTGCTGCT Chr17:32350450..32350469 60.21 50
downstream ENSMUSE00000137079 Chr17:32349784..32350079 TCGTGGGTACTGGTTCCTTC Chr17:32350035..32350054 59.97 55
downstream ENSMUSE00000547571 Chr17:32348112..32348222 AGAACCAGCAATCACGTCAA Chr17:32348172..32348191 59.29 45
downstream ENSMUSE00000699479 Chr17:32343614..32343938 TATAGCTCGCTGGGAAGGAA Chr17:32343843..32343862 59.94 50
downstream ENSMUSE00000713464 Chr17:32341855..32343940 CCGGGAACAGAAAACTACCA Chr17:32342105..32342124 59.96 50
downstream ENSMUSE00000137081 Chr17:32339613..32339665 TTTTGACTTGGGAGCCATCT Chr17:32339624..32339643 59.67 45
downstream ENSMUSE00000137082 Chr17:32339119..32339491 GAAGTGGCCAATAGGGTCAA Chr17:32339209..32339228 59.93 50
downstream ENSMUSE00000137070 Chr17:32337947..32338537 CACCTTCACGGAAGGGAGTA Chr17:32338247..32338266 60.1 55
downstream ENSMUSE00000310779 Chr17:32335841..32336215 CTGCGAATGATTGGTGAGTG Chr17:32335899..32335918 60.26 50
downstream ENSMUSE00000137091 Chr17:32335628..32335758 TTTTTGGCTCCTGCTTCTGT Chr17:32335626..32335645 59.99 45
downstream ENSMUSE00000137087 Chr17:32335302..32335507 ACTTGAGGACTTGGCTGTGG Chr17:32335399..32335418 60.3 55
downstream ENSMUSE00000137078 Chr17:32334976..32335219 CTGCTGCTGCTCCTGTCTCT Chr17:32335086..32335105 61.05 60
downstream ENSMUSE00000423965 Chr17:32333221..32334765 CAGTCACCCCTGTCCAAACT Chr17:32334015..32334034 60 55
downstream ENSMUSE00000711346 Chr17:32333219..32334765 CAGTCACCCCTGTCCAAACT Chr17:32334015..32334034 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGATTGGAGGACGGGCTA Chr17:32405969..32405989 60.95 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACGTGACTGGGAAAACC Chr17:32405940..32405960 60.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTTTGAAGCTGGGAAACCAC Chr17:32406019..32406039 60.09 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTTTGAAGCTGGGAAACCAC Chr17:32406019..32406039 60.09 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024002