Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16469
Trapped Gene
Skil (ENSMUSG00000027660)
Vector Insertion
Chr 3: 30994080 - 30995624
Public Clones (sanger) (sanger) (sanger) (sanger) (ggtc) 3SE091D11 (ggtc)
3SD082F03 (ggtc) PST22430-NR (escells) PST17183-NR (escells) PST21650-NL (escells)
IST14765E4 (tigm) IST14764E6 (tigm) IST15002F4 (tigm) IST14603C6 (tigm)
IST14222B10 (tigm) IST14993B10 (tigm)
Private Clones OST460292 (lexicon) OST390597 (lexicon) OST292776 (lexicon) OST237024 (lexicon)
OST218981 (lexicon) OST185137 (lexicon) OST62406 (lexicon) OST51929 (lexicon)
OST32803 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676089 (Chr3:30993983..30994079 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGGCTGTGTGTAGCGATG Chr3:30993986..30994005 59.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676089 (Chr3:30993983..30994079 +)
Downstram Exon
ENSMUSE00000714563 (Chr3:30995625..30996112 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGGCTGTGTGTAGCGATG Chr3:30993986..30994005 59.06 55 GCAGGTATCGTCCCTGAAAA Chr3:30995782..30995801 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720909 Chr3:30993980..30994079 AGAGGCTGTGTGTAGCGATG Chr3:30993986..30994005 59.06 55
upstream ENSMUSE00000676089 Chr3:30993983..30994079 AGAGGCTGTGTGTAGCGATG Chr3:30993986..30994005 59.06 55
upstream ENSMUSE00000710533 Chr3:30994047..30994079 No primer for this exon

*** Putative Vector Insertion (Chr 3: 30994080 - 30995624) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000365462 Chr3:30995625..30997341 GCAGGTATCGTCCCTGAAAA Chr3:30995782..30995801 60.07 50
downstream ENSMUSE00000714563 Chr3:30995625..30996112 GCAGGTATCGTCCCTGAAAA Chr3:30995782..30995801 60.07 50
downstream ENSMUSE00000719433 Chr3:30995625..30997341 GCAGGTATCGTCCCTGAAAA Chr3:30995782..30995801 60.07 50
downstream ENSMUSE00000708585 Chr3:30995755..30997341 GCAGGTATCGTCCCTGAAAA Chr3:30995782..30995801 60.07 50
downstream ENSMUSE00000708811 Chr3:30996192..30996387 GCAACTGGCATGTTGTTCTC Chr3:30996224..30996243 59.3 50
downstream ENSMUSE00000715640 Chr3:30996628..30997341 GAGTCTTTGTGCATCGGTCA Chr3:30996933..30996952 59.84 50
downstream ENSMUSE00000171865 Chr3:31010547..31010644 CCATTCCCGATGGTGTATCT Chr3:31010571..31010590 59.63 50
downstream ENSMUSE00000171866 Chr3:31012330..31012562 AGATGTGAGCGACACATTCG Chr3:31012387..31012406 59.86 50
downstream ENSMUSE00000719075 Chr3:31012330..31012424 AGATGTGAGCGACACATTCG Chr3:31012387..31012406 59.86 50
downstream ENSMUSE00000171863 Chr3:31015738..31015961 CATGATCTTCCCCTTGTCGT Chr3:31015886..31015905 59.93 50
downstream ENSMUSE00000171864 Chr3:31016295..31016519 TCCTTCATCGCCTTTGAACT Chr3:31016335..31016354 59.81 45
downstream ENSMUSE00000335516 Chr3:31017377..31021499 AAGCCAACCTTACGAGAGCA Chr3:31019636..31019655 60.01 50
downstream ENSMUSE00000717340 Chr3:31017377..31017913 TCAAAGCAAGCGACAAACAC Chr3:31017599..31017618 60.03 45
downstream ENSMUSE00000718136 Chr3:31017377..31018202 TCAAAGCAAGCGACAAACAC Chr3:31017599..31017618 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000027660