Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16471
Trapped Gene
Ptgfrn (ENSMUSG00000027864)
Vector Insertion
Chr 3: 100854121 - 100860158
Public Clones not available
Private Clones OST460261 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000319924 (Chr3:100860159..100860578 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTCCCAACGAGACCAAGT Chr3:100860408..100860427 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000319924 (Chr3:100860159..100860578 -)
Downstram Exon
ENSMUSE00000319916 (Chr3:100854013..100854120 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTCCCAACGAGACCAAGT Chr3:100860408..100860427 60.15 55 CTGAATGCACAGAGGCGTTA Chr3:100854069..100854088 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662316 Chr3:100914015..100914089 No primer for this exon
upstream ENSMUSE00000662315 Chr3:100884051..100884419 CGACTGGAGCTTCTCGTCTT Chr3:100884282..100884301 59.74 55
upstream ENSMUSE00000319945 Chr3:100880966..100881379 GTCAGCGAGTGGATCACAGA Chr3:100881034..100881053 59.99 55
upstream ENSMUSE00000319939 Chr3:100876733..100877113 ACAACAGACCGTGTGGATGA Chr3:100877023..100877042 60.01 50
upstream ENSMUSE00000319933 Chr3:100864560..100864985 AGCTTCTCGCAGTCATGGAT Chr3:100864795..100864814 59.98 50
upstream ENSMUSE00000319924 Chr3:100860159..100860578 CAGTCCCAACGAGACCAAGT Chr3:100860408..100860427 60.15 55

*** Putative Vector Insertion (Chr 3: 100854121 - 100860158) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000319916 Chr3:100854013..100854120 CTGAATGCACAGAGGCGTTA Chr3:100854069..100854088 60.01 50
downstream ENSMUSE00000319910 Chr3:100849367..100849672 AAGAATTCCAGCACGCTCAC Chr3:100849488..100849507 60.41 50
downstream ENSMUSE00000662314 Chr3:100844159..100847445 TTAAGGCTAAGGTGGCGAGA Chr3:100846537..100846556 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCTTCCAGTAATCGCCTTG Chr3:100857108..100857129 60.26 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGTCTTCCAGCGTGACTG Chr3:100857111..100857131 59.05 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027864