Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16497
Trapped Gene
Dab2ip (ENSMUSG00000026883)
Vector Insertion
Chr 2: 35563167 - 35563322
Public Clones CMHD-GT_453G8-3 (cmhd)
Private Clones OST459718 (lexicon) OST458458 (lexicon) OST399370 (lexicon) OST375927 (lexicon)
OST348452 (lexicon) OST331940 (lexicon) OST326498 (lexicon) OST324546 (lexicon)
OST316829 (lexicon) OST254957 (lexicon) OST113234 (lexicon) OST63485 (lexicon)
OST57127 (lexicon) OST53823 (lexicon) OST38009 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000715485 (Chr2:35563168..35563321 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTGGGTCAGGACTACTGC Chr2:35563296..35563315 60.26 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000715485 (Chr2:35563168..35563321 +)
Downstram Exon
ENSMUSE00000710455 (Chr2:35563168..35563321 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTGGGTCAGGACTACTGC Chr2:35563296..35563315 60.26 60 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693906 Chr2:35414093..35414132 No primer for this exon
upstream ENSMUSE00000693848 Chr2:35436580..35436653 ACAACTCCGTGTGTGCAGAT Chr2:35436594..35436613 59.18 50
upstream ENSMUSE00000709561 Chr2:35477570..35477803 TCCTACTACTACCGGCTGCTG Chr2:35477722..35477742 59.55 57.14
upstream ENSMUSE00000719076 Chr2:35477570..35477803 TCCTACTACTACCGGCTGCTG Chr2:35477722..35477742 59.55 57.14
upstream ENSMUSE00000645662 Chr2:35477680..35477803 TCCTACTACTACCGGCTGCTG Chr2:35477722..35477742 59.55 57.14
upstream ENSMUSE00000645669 Chr2:35499408..35499511 GCAGCATGTCAGAGAAAAACC Chr2:35499450..35499470 59.87 47.62
upstream ENSMUSE00000711722 Chr2:35499408..35499511 GCAGCATGTCAGAGAAAAACC Chr2:35499450..35499470 59.87 47.62
upstream ENSMUSE00000714944 Chr2:35499408..35499511 GCAGCATGTCAGAGAAAAACC Chr2:35499450..35499470 59.87 47.62
upstream ENSMUSE00000567506 Chr2:35517012..35517145 No primer for this exon
upstream ENSMUSE00000693841 Chr2:35517012..35517145 No primer for this exon
upstream ENSMUSE00000693836 Chr2:35517057..35517145 No primer for this exon
upstream ENSMUSE00000712519 Chr2:35547514..35547930 CTTGGACCTGGAGGCTACTG Chr2:35547544..35547563 59.86 60
upstream ENSMUSE00000719657 Chr2:35547514..35547930 CTTGGACCTGGAGGCTACTG Chr2:35547544..35547563 59.86 60
upstream ENSMUSE00000693828 Chr2:35552252..35552327 TGAGGTTAGCAGGGAACAGC Chr2:35552271..35552290 60.4 55

*** Putative Vector Insertion (Chr 2: 35563167 - 35563322) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000707384 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000709774 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000710455 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000711228 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000715485 Chr2:35563168..35563321 ACTCGTGTGACCGAGACTCC Chr2:35563214..35563233 60.31 60
downstream ENSMUSE00000693825 Chr2:35563720..35563876 GTTGCAACCCCAATGTTTTC Chr2:35563838..35563857 60.21 45
downstream ENSMUSE00000693827 Chr2:35563727..35563876 GTTGCAACCCCAATGTTTTC Chr2:35563838..35563857 60.21 45
downstream ENSMUSE00000603488 Chr2:35564334..35564432 CCTCAGGTTCTCCATCCACT Chr2:35564414..35564433 59.1 55
downstream ENSMUSE00000721356 Chr2:35564334..35564432 CCTCAGGTTCTCCATCCACT Chr2:35564414..35564433 59.1 55
downstream ENSMUSE00000721396 Chr2:35564334..35564432 CCTCAGGTTCTCCATCCACT Chr2:35564414..35564433 59.1 55
downstream ENSMUSE00000645656 Chr2:35565338..35565892 TTGAGCTTGCTTGTGGTACG Chr2:35565474..35565493 60.05 50
downstream ENSMUSE00000717523 Chr2:35565338..35565892 TTGAGCTTGCTTGTGGTACG Chr2:35565474..35565493 60.05 50
downstream ENSMUSE00000718572 Chr2:35565338..35565892 TTGAGCTTGCTTGTGGTACG Chr2:35565474..35565493 60.05 50
downstream ENSMUSE00000603491 Chr2:35568386..35568530 GTTCTCCCGGAAGATGAGGT Chr2:35568463..35568482 60.46 55
downstream ENSMUSE00000693898 Chr2:35568386..35568530 GTTCTCCCGGAAGATGAGGT Chr2:35568463..35568482 60.46 55
downstream ENSMUSE00000603490 Chr2:35568626..35568770 GCTTGGGTCCACTTCACAAT Chr2:35568684..35568703 59.97 50
downstream ENSMUSE00000693897 Chr2:35568626..35568770 GCTTGGGTCCACTTCACAAT Chr2:35568684..35568703 59.97 50
downstream ENSMUSE00000163861 Chr2:35570789..35571025 ATGAGGCGAACACCTCCTTA Chr2:35570829..35570848 59.69 50
downstream ENSMUSE00000693896 Chr2:35570789..35571025 ATGAGGCGAACACCTCCTTA Chr2:35570829..35570848 59.69 50
downstream ENSMUSE00000163860 Chr2:35572591..35572792 GCTGTGTTGGAAAGGGTCTC Chr2:35572710..35572729 59.7 55
downstream ENSMUSE00000693895 Chr2:35572591..35572792 GCTGTGTTGGAAAGGGTCTC Chr2:35572710..35572729 59.7 55
downstream ENSMUSE00000163862 Chr2:35574280..35574458 GGACATCCCTCAGGATACGA Chr2:35574331..35574350 59.89 55
downstream ENSMUSE00000693892 Chr2:35574280..35574458 GGACATCCCTCAGGATACGA Chr2:35574331..35574350 59.89 55
downstream ENSMUSE00000257703 Chr2:35575373..35576261 CGTGGGTACTGTAGGGTGCT Chr2:35576137..35576156 60.05 60
downstream ENSMUSE00000693890 Chr2:35575373..35576261 CGTGGGTACTGTAGGGTGCT Chr2:35576137..35576156 60.05 60
downstream ENSMUSE00000257694 Chr2:35576781..35576933 TTCTAACAACTGCGCGTTCA Chr2:35576861..35576880 60.58 45
downstream ENSMUSE00000693885 Chr2:35576781..35576933 TTCTAACAACTGCGCGTTCA Chr2:35576861..35576880 60.58 45
downstream ENSMUSE00000257688 Chr2:35578549..35578742 TCTTGGTGGAGATCCGTAGC Chr2:35578594..35578613 60.22 55
downstream ENSMUSE00000693879 Chr2:35578549..35578742 TCTTGGTGGAGATCCGTAGC Chr2:35578594..35578613 60.22 55
downstream ENSMUSE00000603489 Chr2:35582946..35583033 TGGAATCTACAGCTGCTTGC Chr2:35583013..35583032 59.18 50
downstream ENSMUSE00000693868 Chr2:35582946..35583033 TGGAATCTACAGCTGCTTGC Chr2:35583013..35583032 59.18 50
downstream ENSMUSE00000163853 Chr2:35583578..35586512 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000645664 Chr2:35583578..35583648 No primer for this exon
downstream ENSMUSE00000693823 Chr2:35583578..35586514 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000693853 Chr2:35583578..35583648 No primer for this exon
downstream ENSMUSE00000693860 Chr2:35583578..35586507 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000693866 Chr2:35583578..35586512 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000693835 Chr2:35584631..35586512 TCAACCGTGAGAGCAGTGTC Chr2:35585770..35585789 60.03 55
downstream ENSMUSE00000693839 Chr2:35584631..35584640 No primer for this exon
downstream ENSMUSE00000645663 Chr2:35585944..35586512 CGATCCAACCTTTGCATTTT Chr2:35586375..35586394 59.94 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCCCTGCTAACCACCTCCT Chr2:35563146..35563166 59.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCCCTGCTAACCACCTCCT Chr2:35563146..35563166 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026883