Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16500
Trapped Gene
Prpf6 (ENSMUSG00000002455)
Vector Insertion
Chr 2: 181380298 - 181381993
Public Clones not available
Private Clones OST459672 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000170875 (Chr2:181380176..181380297 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000170875 (Chr2:181380176..181380297 +)
Downstram Exon
ENSMUSE00000170885 (Chr2:181381994..181382132 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414602 Chr2:181336073..181336236 No primer for this exon
upstream ENSMUSE00000170890 Chr2:181342825..181342993 No primer for this exon
upstream ENSMUSE00000170891 Chr2:181350682..181350800 No primer for this exon
upstream ENSMUSE00000170889 Chr2:181355274..181355352 No primer for this exon
upstream ENSMUSE00000170887 Chr2:181356492..181356668 No primer for this exon
upstream ENSMUSE00000329428 Chr2:181356867..181357022 No primer for this exon
upstream ENSMUSE00000329422 Chr2:181366140..181366234 No primer for this exon
upstream ENSMUSE00000170874 Chr2:181366636..181366792 No primer for this exon
upstream ENSMUSE00000170882 Chr2:181367460..181367622 No primer for this exon
upstream ENSMUSE00000170884 Chr2:181370738..181370856 No primer for this exon
upstream ENSMUSE00000170873 Chr2:181371598..181371816 No primer for this exon
upstream ENSMUSE00000170880 Chr2:181375297..181375419 No primer for this exon
upstream ENSMUSE00000170875 Chr2:181380176..181380297 No primer for this exon

*** Putative Vector Insertion (Chr 2: 181380298 - 181381993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170885 Chr2:181381994..181382132 No primer for this exon
downstream ENSMUSE00000170881 Chr2:181383731..181383850 No primer for this exon
downstream ENSMUSE00000329373 Chr2:181384127..181384303 No primer for this exon
downstream ENSMUSE00000170883 Chr2:181384802..181384935 No primer for this exon
downstream ENSMUSE00000170879 Chr2:181385791..181385882 No primer for this exon
downstream ENSMUSE00000170872 Chr2:181387139..181387253 No primer for this exon
downstream ENSMUSE00000402366 Chr2:181389541..181389667 No primer for this exon
downstream ENSMUSE00000379444 Chr2:181390127..181390365 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCTATTTGCATGGTGCTG Chr2:181380318..181380338 59.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCTATTTGCATGGTGCTG Chr2:181380318..181380338 59.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002455