Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16520
Trapped Gene
Csrp2 (ENSMUSG00000020186)
Vector Insertion
Chr 10: 110374923 - 110375692
Public Clones not available
Private Clones OST459205 (lexicon) OST459061 (lexicon) OST242612 (lexicon)
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000101596 (Chr10:110374793..110374922 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000101596 (Chr10:110374793..110374922 +)
Downstram Exon
ENSMUSE00000573921 (Chr10:110375693..110375786 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000369473 Chr10:110357235..110357310 No primer for this exon
upstream ENSMUSE00000101586 Chr10:110369011..110369123 No primer for this exon
upstream ENSMUSE00000101593 Chr10:110372204..110372372 No primer for this exon
upstream ENSMUSE00000101596 Chr10:110374793..110374922 No primer for this exon

*** Putative Vector Insertion (Chr 10: 110374923 - 110375692) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000573921 Chr10:110375693..110375786 No primer for this exon
downstream ENSMUSE00000438184 Chr10:110376267..110376678 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTGGAGCTGGGAAGGTAG Chr10:110374908..110374928 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTGGAGCTGGGAAGGTAG Chr10:110374908..110374928 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020186