Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16521
Trapped Gene
Isyna1 (ENSMUSG00000019139)
Vector Insertion
Chr 8: 73120811 - 73120895
Public Clones not available
Private Clones OST459203 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000388575 (Chr8:73120593..73120810 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000388575 (Chr8:73120593..73120810 +)
Downstram Exon
ENSMUSE00000347693 (Chr8:73120896..73121187 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581981 Chr8:73118389..73118442 No primer for this exon
upstream ENSMUSE00000382178 Chr8:73118519..73118647 No primer for this exon
upstream ENSMUSE00000435893 Chr8:73118722..73118883 No primer for this exon
upstream ENSMUSE00000342614 Chr8:73119038..73119170 No primer for this exon
upstream ENSMUSE00000213733 Chr8:73119260..73119453 No primer for this exon
upstream ENSMUSE00000213732 Chr8:73119604..73119753 No primer for this exon
upstream ENSMUSE00000213734 Chr8:73119849..73120064 No primer for this exon
upstream ENSMUSE00000213730 Chr8:73120147..73120311 No primer for this exon
upstream ENSMUSE00000373289 Chr8:73120395..73120508 No primer for this exon
upstream ENSMUSE00000388575 Chr8:73120593..73120810 No primer for this exon

*** Putative Vector Insertion (Chr 8: 73120811 - 73120895) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000347693 Chr8:73120896..73121187 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCCTTATAATCGCCTTGC Chr8:73120854..73120874 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGGCAAAGACAGCCTTAC Chr8:73120843..73120863 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019139