Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI16525
Trapped Gene
Herc1 (ENSMUSG00000038664)
Vector Insertion
Chr 9: 66198429 - 66219618
Public Clones (sanger) (sanger) IST14147B11 (tigm) IST10469E11 (tigm) IST11408F8 (tigm)
Private Clones OST459170 (lexicon) OST443596 (lexicon) OST325604 (lexicon) OST223193 (lexicon)
OST63320 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696881 (Chr9:66198333..66198428 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696881 (Chr9:66198333..66198428 +)
Downstram Exon
ENSMUSE00000696870 (Chr9:66219619..66220461 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGTTCGGACACCCATTTCT Chr9:66220114..66220133 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000421026 Chr9:66198331..66198428 No primer for this exon
upstream ENSMUSE00000696881 Chr9:66198333..66198428 No primer for this exon

*** Putative Vector Insertion (Chr 9: 66198429 - 66219618) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000373072 Chr9:66219593..66220548 CAGTTCGGACACCCATTTCT Chr9:66220114..66220133 59.97 50
downstream ENSMUSE00000709541 Chr9:66219593..66220548 CAGTTCGGACACCCATTTCT Chr9:66220114..66220133 59.97 50
downstream ENSMUSE00000532422 Chr9:66219619..66220548 CAGTTCGGACACCCATTTCT Chr9:66220114..66220133 59.97 50
downstream ENSMUSE00000696870 Chr9:66219619..66220461 CAGTTCGGACACCCATTTCT Chr9:66220114..66220133 59.97 50
downstream ENSMUSE00000696867 Chr9:66221423..66221443 No primer for this exon
downstream ENSMUSE00000243541 Chr9:66224124..66224219 No primer for this exon
downstream ENSMUSE00000243517 Chr9:66232800..66232994 CTAGGAGCCAGTTTGGGTTG Chr9:66232978..66232997 59.73 55
downstream ENSMUSE00000243490 Chr9:66234406..66234717 TGTAGTGGGCCCTGGATAAG Chr9:66234713..66234732 59.95 55
downstream ENSMUSE00000497296 Chr9:66235968..66236064 CTTCCGAAGTCTCCTTCACC Chr9:66236062..66236081 58.87 55
downstream ENSMUSE00000243438 Chr9:66236562..66236705 TCACCTCCTCCAAAAGACCA Chr9:66236703..66236722 60.62 50
downstream ENSMUSE00000503199 Chr9:66239167..66239294 CCAGCACAGACTTTGCGAAT Chr9:66239260..66239279 61.38 50
downstream ENSMUSE00000383369 Chr9:66242467..66242611 GAGCTTGGGTCTCAAAGCAG Chr9:66242541..66242560 60.13 55
downstream ENSMUSE00000501424 Chr9:66242735..66242906 AGAGCAGTCCATGCCAAACT Chr9:66242897..66242916 59.87 50
downstream ENSMUSE00000420748 Chr9:66244443..66244577 TTGATGAAGGGAAAGGCAGT Chr9:66244579..66244598 59.67 45
downstream ENSMUSE00000379523 Chr9:66245060..66245225 TGGGACAGTTGAATCCATCA Chr9:66245213..66245232 59.89 45
downstream ENSMUSE00000365226 Chr9:66245645..66245770 CATGGTTGCTCCAACTGAGA Chr9:66245683..66245702 59.83 50
downstream ENSMUSE00000420735 Chr9:66247065..66247286 AAATTTCGGCCAGATGAGTG Chr9:66247251..66247270 60.07 45
downstream ENSMUSE00000243326 Chr9:66247575..66247727 TTTCCAGCTCTCCAAATGCT Chr9:66247602..66247621 59.96 45
downstream ENSMUSE00000243302 Chr9:66247854..66247986 AACACTGCCATTCCAAGGAC Chr9:66247973..66247992 59.97 50
downstream ENSMUSE00000243280 Chr9:66250331..66250522 AAAGGACGAGCCACTGACAC Chr9:66250421..66250440 60.31 55
downstream ENSMUSE00000384286 Chr9:66255791..66256012 ACCCAAGATTGAGCTGGTTG Chr9:66255854..66255873 60.11 50
downstream ENSMUSE00000420717 Chr9:66258823..66258996 TTCAGGCCGCAATTTGTAAT Chr9:66258908..66258927 60.46 40
downstream ENSMUSE00000584160 Chr9:66258823..66258863 No primer for this exon
downstream ENSMUSE00000532489 Chr9:66261882..66261996 TGTTTGAGGAGTGCTGCAAG Chr9:66261963..66261982 60.17 50
downstream ENSMUSE00000635977 Chr9:66261882..66262000 TGTTTGAGGAGTGCTGCAAG Chr9:66261963..66261982 60.17 50
downstream ENSMUSE00000532488 Chr9:66262086..66262206 CTCGTGATGATGACCTGGTTT Chr9:66262200..66262220 59.98 47.62
downstream ENSMUSE00000635976 Chr9:66262093..66262206 CTCGTGATGATGACCTGGTTT Chr9:66262200..66262220 59.98 47.62
downstream ENSMUSE00000532487 Chr9:66263991..66264162 GGTCCGGGTAAAGGAATGTT Chr9:66264053..66264072 60.05 50
downstream ENSMUSE00000532485 Chr9:66266203..66266515 CGGCTACGAGCTACTTCTCG Chr9:66266251..66266270 60.31 60
downstream ENSMUSE00000532484 Chr9:66266936..66267056 ATGAACTAGGCGGCTCTCAG Chr9:66266975..66266994 59.6 55
downstream ENSMUSE00000532483 Chr9:66268804..66268855 No primer for this exon
downstream ENSMUSE00000532482 Chr9:66276618..66276886 GTTTCAGGCGAGTCCAAGAG Chr9:66276674..66276693 59.99 55
downstream ENSMUSE00000532481 Chr9:66281083..66281298 TTCCCGTGTGTCCAACAGTA Chr9:66281266..66281285 60 50
downstream ENSMUSE00000532480 Chr9:66281531..66281651 ACAGCCACCTGGATTTCAAC Chr9:66281586..66281605 59.97 50
downstream ENSMUSE00000532479 Chr9:66281873..66282110 GGGCTGTCCTAACATGGTGT Chr9:66282018..66282037 59.85 55
downstream ENSMUSE00000532477 Chr9:66282218..66282405 TTGGGGCTCAGTTTATCAGC Chr9:66282247..66282266 60.21 50
downstream ENSMUSE00000532476 Chr9:66285402..66285557 TCCCCTAGATGGAGTTCAGC Chr9:66285447..66285466 59.24 55
downstream ENSMUSE00000532475 Chr9:66286985..66287091 AGCCTCAAGGACGTGAAGAG Chr9:66287046..66287065 59.6 55
downstream ENSMUSE00000635970 Chr9:66287603..66287713 CAATCCGACAGAAGGGAAAA Chr9:66287640..66287659 60.04 45
downstream ENSMUSE00000532469 Chr9:66289710..66289886 CCATTTTCCACAATGCAACA Chr9:66289807..66289826 60.36 40
downstream ENSMUSE00000420699 Chr9:66293260..66293499 AAGCTGGACAGCGTCAGAGT Chr9:66293429..66293448 60.21 55
downstream ENSMUSE00000420693 Chr9:66293892..66293975 TCTGCTGCATCCACATCTTC Chr9:66293932..66293951 59.95 50
downstream ENSMUSE00000361061 Chr9:66295819..66296339 GGTCTGTCCGGTGAAGGATA Chr9:66295954..66295973 59.93 55
downstream ENSMUSE00000219238 Chr9:66298510..66299285 TTTCATGTCGCTTGATGCTC Chr9:66298688..66298707 59.96 45
downstream ENSMUSE00000343738 Chr9:66301144..66301342 TGCTGTGCTTGGTCACTTTC Chr9:66301186..66301205 60.03 50
downstream ENSMUSE00000242882 Chr9:66303743..66303903 CACGGCGTGTAGGAAGTACA Chr9:66303795..66303814 59.78 55
downstream ENSMUSE00000242856 Chr9:66305244..66305360 GAGGGGACGTTGAAAGTCTG Chr9:66305285..66305304 59.7 55
downstream ENSMUSE00000242842 Chr9:66306001..66306232 ACCACTTCCCAGAACTGTCG Chr9:66306146..66306165 60.15 55
downstream ENSMUSE00000242826 Chr9:66308215..66308339 AGTTGGTGGTCCACTTCCAG Chr9:66308272..66308291 60 55
downstream ENSMUSE00000332324 Chr9:66309507..66309727 CCAGGTAGGCCAATCCAGTA Chr9:66309730..66309749 59.95 55
downstream ENSMUSE00000381364 Chr9:66310636..66310904 CACGACCACTTCTTCCCTGT Chr9:66310677..66310696 60.15 55
downstream ENSMUSE00000332837 Chr9:66312513..66312565 TGTCCTGCTTGCCAATTAGA Chr9:66312556..66312575 59.42 45
downstream ENSMUSE00000242738 Chr9:66313188..66313388 AGTGGTCCAGCAAGCAATTC Chr9:66313269..66313288 60.26 50
downstream ENSMUSE00000242716 Chr9:66314306..66314480 ACTCGGTCATGAGGATTTGC Chr9:66314396..66314415 60.08 50
downstream ENSMUSE00000242696 Chr9:66315190..66315460 AGGTAGGCCAGGCAAGAAAT Chr9:66315390..66315409 60.1 50
downstream ENSMUSE00000242676 Chr9:66315567..66315780 TAGGAACTTCCGCTGAATGG Chr9:66315638..66315657 60.21 50
downstream ENSMUSE00000412190 Chr9:66316785..66316990 TTTGGTTGTCACGGTCATGT Chr9:66316913..66316932 59.85 45
downstream ENSMUSE00000342407 Chr9:66318045..66318172 ATTCCACACCCGAATAGTGC Chr9:66318125..66318144 59.82 50
downstream ENSMUSE00000635962 Chr9:66319653..66319780 CCAGCAAGGTATTTGCCACT Chr9:66319745..66319764 60.13 50
downstream ENSMUSE00000635961 Chr9:66321190..66321390 CGGTGCATAGTGGACACATC Chr9:66321361..66321380 59.99 55
downstream ENSMUSE00000635960 Chr9:66322541..66322671 CACTGAACCAAGCAATGCAG Chr9:66322573..66322592 60.45 50
downstream ENSMUSE00000635958 Chr9:66323728..66323927 AATGTAGACAGCGCCAGCAT Chr9:66323845..66323864 60.83 50
downstream ENSMUSE00000635957 Chr9:66324135..66324240 TGAGGAATACGCCAAACACA Chr9:66324179..66324198 60.11 45
downstream ENSMUSE00000635956 Chr9:66326752..66326898 GTCCGAACAGGTGTGATGTG Chr9:66326825..66326844 60.01 55
downstream ENSMUSE00000635955 Chr9:66327238..66327339 AGCTCCAGAGCCGATTACAA Chr9:66327282..66327301 59.98 50
downstream ENSMUSE00000635954 Chr9:66328669..66328842 AATCCCAGAACACCCTGTTG Chr9:66328769..66328788 59.82 50
downstream ENSMUSE00000532443 Chr9:66329611..66329904 TGCAGCCTTGATAGTGGTTG Chr9:66329817..66329836 59.86 50
downstream ENSMUSE00000532442 Chr9:66331464..66331529 GTCTGGAAGTTGCCCAAGAC Chr9:66331527..66331546 59.7 55
downstream ENSMUSE00000532441 Chr9:66331685..66331810 GCCAGCACCCCATAAGTAGA Chr9:66331735..66331754 60.1 55
downstream ENSMUSE00000532440 Chr9:66332706..66332844 CCTTGCCCTAATCTGCCATA Chr9:66332800..66332819 60.05 50
downstream ENSMUSE00000532439 Chr9:66333874..66334055 TTTGCCATAGTCCCCATCTC Chr9:66333983..66334002 59.89 50
downstream ENSMUSE00000532438 Chr9:66334731..66334886 GTTTGCCATCCGATGTTACC Chr9:66334782..66334801 60.2 50
downstream ENSMUSE00000532437 Chr9:66335756..66335878 GACACTGCCAAGGTGTGGTT Chr9:66335793..66335812 61.03 55
downstream ENSMUSE00000532436 Chr9:66337137..66337239 TGAGTTCCACAAGCAACCTTT Chr9:66337191..66337211 59.77 42.86
downstream ENSMUSE00000532435 Chr9:66339765..66339934 TTGCTACCCCAGGCATAAAC Chr9:66339924..66339943 59.96 50
downstream ENSMUSE00000532434 Chr9:66340963..66341101 GTTGGTTCTCGAACGTGGTT Chr9:66341003..66341022 60.01 50
downstream ENSMUSE00000532433 Chr9:66343707..66343876 TTCAGCAACCTCCATGATGA Chr9:66343860..66343879 60.2 45
downstream ENSMUSE00000532432 Chr9:66344976..66345145 GCTAACAGAGGCCGAAGTTG Chr9:66345046..66345065 60.01 55
downstream ENSMUSE00000532430 Chr9:66345396..66345561 GACGGAGGTCTGATGCATTT Chr9:66345472..66345491 60.08 50
downstream ENSMUSE00000532429 Chr9:66346487..66346563 AACCGACTTCTGCAGTAGCAT Chr9:66346552..66346572 59.02 47.62
downstream ENSMUSE00000532427 Chr9:66348983..66349235 AGCTGTTTCCACACCAGAGG Chr9:66349120..66349139 60.3 55
downstream ENSMUSE00000242257 Chr9:66349737..66349889 CTCTGGCCGACAAAAGAATC Chr9:66349771..66349790 59.81 50
downstream ENSMUSE00000532426 Chr9:66352395..66352700 GACATCCCTTCTCGAACTGC Chr9:66352423..66352442 59.81 55
downstream ENSMUSE00000696877 Chr9:66355946..66356582 CAATTGAACGGCAGTTGTTG Chr9:66356069..66356088 60.15 45
downstream ENSMUSE00000696882 Chr9:66355946..66356575 CAATTGAACGGCAGTTGTTG Chr9:66356069..66356088 60.15 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCGAGTGTGTGATCGTA Chr9:66216462..66216482 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACACGTTCTCTTTCGCCATC Chr9:66198437..66198457 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038664